LYZL6 (NM_001199951) Human Untagged Clone

CAT#: SC329599

LYZL6 (untagged) - Homo sapiens lysozyme-like 6 (LYZL6), transcript variant 1


  "NM_001199951" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "LYZL6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LYZL6
Synonyms HEL-S-6a; LYC1; LYZB; PRO1485; TKAL754; UNQ754
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001199951, the custom clone sequence may differ by one or more nucleotides


ATGACAAAGGCGCTACTCATCTATTTGGTCAGCAGCTTTCTTGCCCTAAATCAGGCCAGCCTCATCAGTC
GCTGTGACTTGGCCCAGGTGCTGCAGCTGGAGGACTTGGATGGGTTTGAGGGTTACTCCCTGAGTGACTG
GCTGTGCCTGGCTTTTGTGGAAAGCAAGTTCAACATATCAAAGATAAATGAAAATGCAGATGGAAGCTTT
GACTATGGCCTCTTCCAGATCAACAGCCACTACTGGTGCAACGATTATAAGAGTTACTCGGAAAACCTTT
GCCACGTAGACTGTCAAGATCTGCTGAATCCCAACCTTCTTGCAGGCATCCACTGCGCAAAAAGGATTGT
GTCCGGAGCACGGGGGATGAACAACTGGGTAGAATGGAGGTTGCACTGTTCAGGCCGGCCACTCTTCTAC
TGGCTGACAGGATGCCGCCTGAGATGA


Restriction Sites SgfI-MluI     
ACCN NM_001199951
ORF Size 447 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001199951.1, NP_001186880.1
RefSeq Size 963
RefSeq ORF 447
Locus ID 57151
Protein Families Secreted Protein
Gene Summary This gene encodes a member of the C-type lysozyme/alpha-lactalbumin family. C-type lysozymes are bacteriolytic factors that play a role in host defense, whereas alpha-lactalbumins mediate lactose biosynthesis. The encoded protein contains catalytic residues characteristic of C-type lysozymes and may play a role in male reproduction. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (1) differs in the 5' UTR, compared to variant 2. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.