NMNAT3 (NM_001200047) Human Untagged Clone

CAT#: SC329613

NMNAT3 (untagged) - Homo sapiens nicotinamide nucleotide adenylyltransferase 3 (NMNAT3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NMNAT3
• Synonyms: FKSG76; PNAT-3; PNAT3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001200047, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGAGCCGAATACCTGTGGTGCTCCTGGCCTGTGGCTCCTTTAACCCCATCACCAACATGCACCTGC
  GCATGTTTGAGGTGGCCAGAGATCACCTACACCAAACAGCTGTGCCTGAGCTGAAGCTTCTCTGTGGGGC
  AGACGTCTTGAAGACCTTCCAGACCCCCAACCTCTGGAAGGATGCGCACATCCAGGAAATAGTGGAGAAG
  TTTGGCTTGGTGTGCGTGGGCCGAGTAGGTCACGACCCAAAAGGTTACATCGCAGAATCTCCCATCCTAC
  GGATGCACCAGCACAACATTCACCTGGCCAAGGAGCCTGTGCAGAATGAGATCAGTGCCACATACATCAG
  GCGAGCCTTGGGCCAAGGGCAGAGCGTAAAGTACCTGATTCCCGATGCTGTCATCACGTACATCAAGGAC
  CATGGCCTCTACACCAAGGGCAGTACCTGGAAAGGCAAAAGCACCCAGAGCACTGAGGGCAAGACAAGCT
  AG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001200047
• ORF Size: 492 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_001200047.1, NP_001186976.1
• RefSeq Size: 1801
• RefSeq ORF: 492
• Locus ID: 349565
• Protein Pathways: Metabolic pathways, Nicotinate and nicotinamide metabolism
• Gene Summary: This gene encodes a member of the nicotinamide/nicotinic acid mononucleotide adenylyltransferase family. These enzymes use ATP to catalyze the synthesis of nicotinamide adenine dinucleotide or nicotinic acid adenine dinucleotide from nicotinamide mononucleotide or nicotinic acid mononucleotide, respectively. The encoded protein is localized to mitochondria and may also play a neuroprotective role as a molecular chaperone. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
  Transcript Variant: This variant (2) lacks three alternate in-frame exons in the 5' coding region, compared to variant 3. The encoded isoform (2) is shorter than isoform 3.