SEM1 (NM_001201450) Human Untagged Clone

CAT#: SC329621

C7orf76 (untagged) - Homo sapiens chromosome 7 open reading frame 76 (C7orf76), transcript variant 1


  "NM_001201450" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SEM1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SEM1
Synonyms C7orf76; DSS1; ECD; SHFD1; Shfdg1; SHFM1; SHSF1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001201450, the custom clone sequence may differ by one or more nucleotides


ATGTATTGCCAGGACTCCAACATTTGTGCTGTGTTTGCTGTACAAGGAGGAAAAGTGGGAAGAAAGCATG
GCATAAAAAGGGGGAGGAGACCCAGCATAAGAAGCCCAGCTCAGCGGGCCAGAGGACCCTGGATCCATGA
GAGTAAGCATCCGGCCTTTGCAAAGCAACAGATAAACTTGGAGATGCCCAACTCCAGAGCGACAACAGAG
TTAGCCTGGGTCTGCAGCTCCACCTCAAGAAAAAAGAAGTGGGCAAGGTCCCTGACTCTTTCCACTGCTC
CACTGAGCCCCCCACCATCCTTGGTGCACTGTGAAGATTGTTCTTGCCTGCCTGGCTGCCATTCGGGTGA
CCTCTACAATCTGGCCCCAGCAGAAAGAACTTGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001201450
ORF Size 387 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001201450.1, NP_001188379.1
RefSeq Size 2707
RefSeq ORF 387
Locus ID 401388
Protein Pathways Homologous recombination, Proteasome
Gene Summary The product of this gene has been localized within the split hand/split foot malformation locus SHFM1 at chromosome 7. It has been proposed to be a candidate gene for the autosomal dominant form of the heterogeneous limb developmental disorder split hand/split foot malformation type 1. In addition, it has been shown to directly interact with BRCA2. It also may play a role in the completion of the cell cycle. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (6) represents the use of an alternate promoter, resulting in a different 5' UTR and use of an alternate start codon, compared to variant 1. It encodes isoform 4, which is longer and has a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.