SEM1 (NM_001201451) Human Untagged Clone
CAT#: SC329622
C7orf76 (untagged) - Homo sapiens chromosome 7 open reading frame 76 (C7orf76), transcript variant 2
"NM_001201451" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "SEM1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SEM1 |
Synonyms | C7orf76; DSS1; ECD; SHFD1; Shfdg1; SHFM1; SHSF1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001201451, the custom clone sequence may differ by one or more nucleotides
ATGTATTGCCAGGACTCCAACATTTGTGCTGTGTTTGCTGTACAAGGAGGAAAAGTGGGAAGAAAGCATG GCATAAAAAGGGGGAGGAGACCCAGCATAAGAAGCCCAGCTCAGCGGGCCAGAGGACCCTGGATCCATGA GAGTAAGCATCCGGCCTTTGCAAAGCAACAGATAAACTTGGAGATGCCCAACTCCAGAGCGACAACAGAG TTAGCCTGGGTCTGCAGGTCCCTGACTCTTTCCACTGCTCCACTGAGCCCCCCACCATCCTTGGTGCACT GTGAAGATTGTTCTTGCCTGCCTGGCTGCCATTCGGGTGACCTCTACAATCTGGCCCCAGCAGAAAGAAC TTGCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001201451 |
ORF Size | 357 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001201451.1, NP_001188380.1 |
RefSeq Size | 2677 |
RefSeq ORF | 357 |
Locus ID | 401388 |
Protein Pathways | Homologous recombination, Proteasome |
Gene Summary | The product of this gene has been localized within the split hand/split foot malformation locus SHFM1 at chromosome 7. It has been proposed to be a candidate gene for the autosomal dominant form of the heterogeneous limb developmental disorder split hand/split foot malformation type 1. In addition, it has been shown to directly interact with BRCA2. It also may play a role in the completion of the cell cycle. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (7) represents the use of an alternate promoter, resulting in a different 5' UTR and use of an alternate start codon, compared to variant 1. It encodes isoform 2, which is shorter and has a distinct N-terminus, compared to isoform 1. Variants 3, 4 and 7 encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.