Non Neuronal Enolase (ENO1) (NM_001201483) Human Untagged Clone

CAT#: SC329628

ENO1 (untagged) - Homo sapiens enolase 1, (alpha) (ENO1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ENO1
• Synonyms: ENO1L1; HEL-S-17; MPB1; NNE; PPH
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001201483, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATCGAGATGGATGGAACAGAAAATAAATCTAAGTTTGGTGCGAACGCCATTCTGGGGGTGTCCCTTG
  CCGTCTGCAAAGCTGGTGCCGTTGAGAAGGGGGTCCCCCTGTACCGCCACATCGCTGACTTGGCTGGCAA
  CTCTGAAGTCATCCTGCCAGTCCCGGCGTTCAATGTCATCAATGGCGGTTCTCATGCTGGCAACAAGCTG
  GCCATGCAGGAGTTCATGATCCTCCCAGTCGGTGCAGCAAACTTCAGGGAAGCCATGCGCATTGGAGCAG
  AGGTTTACCACAACCTGAAGAATGTCATCAAGGAGAAATATGGGAAAGATGCCACCAATGTGGGGGATGA
  AGGCGGGTTTGCTCCCAACATCCTGGAGAATAAAGAAGGCCTGGAGCTGCTGAAGACTGCTATTGGGAAA
  GCTGGCTACACTGATAAGGTGGTCATCGGCATGGACGTAGCGGCCTCCGAGTTCTTCAGGTCTGGGAAGT
  ATGACCTGGACTTCAAGTCTCCCGATGACCCCAGCAGGTACATCTCGCCTGACCAGCTGGCTGACCTGTA
  CAAGTCCTTCATCAAGGACTACCCAGTGGTGTCTATCGAAGATCCCTTTGACCAGGATGACTGGGGAGCT
  TGGCAGAAGTTCACAGCCAGTGCAGGAATCCAGGTAGTGGGGGATGATCTCACAGTGACCAACCCAAAGA
  GGATCGCCAAGGCCGTGAACGAGAAGTCCTGCAACTGCCTCCTGCTCAAAGTCAACCAGATTGGCTCCGT
  GACCGAGTCTCTTCAGGCGTGCAAGCTGGCCCAGGCCAATGGTTGGGGCGTCATGGTGTCTCATCGTTCG
  GGGGAGACTGAAGATACCTTCATCGCTGACCTGGTTGTGGGGCTGTGCACTGGGCAGATCAAGACTGGTG
  CCCCTTGCCGATCTGAGCGCTTGGCCAAGTACAACCAGCTCCTCAGAATTGAAGAGGAGCTGGGCAGCAA
  GGCTAAGTTTGCCGGCAGGAACTTCAGAAACCCCTTGGCCAAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001201483
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001201483.1, NP_001188412.1
• RefSeq Size: 2567 bp
• RefSeq ORF: 1026 bp
• Locus ID: 2023
• Cytogenetics: 1p36.23
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Glycolysis / Gluconeogenesis, Metabolic pathways, RNA degradation
• Gene Summary: 'This gene encodes alpha-enolase, one of three enolase isoenzymes found in mammals. Each isoenzyme is a homodimer composed of 2 alpha, 2 gamma, or 2 beta subunits, and functions as a glycolytic enzyme. Alpha-enolase in addition, functions as a structural lens protein (tau-crystallin) in the monomeric form. Alternative splicing of this gene results in a shorter isoform that has been shown to bind to the c-myc promoter and function as a tumor suppressor. Several pseudogenes have been identified, including one on the long arm of chromosome 1. Alpha-enolase has also been identified as an autoantigen in Hashimoto encephalopathy. [provided by RefSeq, Jan 2011]'
  Transcript Variant: This variant (2) differs at the 5' end compared to variant 1, and initiates translation from a downstream in-frame start codon, resulting in a shorter isoform (MBP-1). This isoform is localized to the nucleus, and functions as a transcriptional repressor of c-myc protooncogene by binding to its promoter (PMID:20849415). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.