Cathepsin V (CTSV) (NM_001201575) Human Untagged Clone

CAT#: SC329640

CTSL2 (untagged) - Homo sapiens cathepsin V (CTSV), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CTSV
• Synonyms: CATL2; CTSL2; CTSU
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001201575, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAATCTTTCGCTCGTCCTGGCTGCCTTTTGCTTGGGAATAGCCTCCGCTGTTCCAAAATTTGACCAAA
  ATTTGGATACAAAGTGGTACCAGTGGAAGGCAACACACAGAAGATTATATGGCGCGAATGAAGAAGGATG
  GAGGAGAGCAGTGTGGGAAAAGAATATGAAAATGATTGAACTGCACAATGGGGAATACAGCCAAGGGAAA
  CATGGCTTCACAATGGCCATGAATGCTTTTGGTGACATGACCAATGAAGAATTCAGGCAGATGATGGGTT
  GCTTTCGAAACCAGAAATTCAGGAAGGGGAAAGTGTTCCGTGAGCCTCTGTTTCTTGATCTTCCCAAATC
  TGTGGATTGGAGAAAGAAAGGCTACGTGACGCCAGTGAAGAATCAGAAACAGTGTGGTTCTTGTTGGGCT
  TTTAGTGCGACTGGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAAACTTGTCTCACTGAGCGAGC
  AGAATCTGGTGGACTGTTCGCGTCCTCAAGGCAATCAGGGCTGCAATGGTGGCTTCATGGCTAGGGCCTT
  CCAGTATGTCAAGGAGAACGGAGGCCTGGACTCTGAGGAATCCTATCCATATGTAGCAGTGGATGAAATC
  TGTAAGTACAGACCTGAGAATTCTGTTGCTAATGACACTGGCTTCACAGTGGTCGCACCTGGAAAGGAGA
  AGGCCCTGATGAAAGCAGTCGCAACTGTGGGGCCCATCTCCGTTGCTATGGATGCAGGCCATTCGTCCTT
  CCAGTTCTACAAATCAGGCATTTATTTTGAACCAGACTGCAGCAGCAAAAACCTGGATCATGGTGTTCTG
  GTGGTTGGCTACGGCTTTGAAGGAGCAAATTCGAATAACAGCAAGTATTGGCTCGTCAAAAACAGCTGGG
  GTCCAGAATGGGGCTCGAATGGCTATGTAAAAATAGCCAAAGACAAGAACAACCACTGTGGAATCGCCAC
  AGCAGCCAGCTACCCCAATGTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001201575
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001201575.1, NP_001188504.1
• RefSeq Size: 4339 bp
• RefSeq ORF: 1005 bp
• Locus ID: 1515
• Cytogenetics: 9q22.33
• Protein Families: Druggable Genome, Protease
• Protein Pathways: Lysosome
• Gene Summary: 'The protein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that may play an important role in corneal physiology. This gene is expressed in colorectal and breast carcinomas but not in normal colon, mammary gland, or peritumoral tissues, suggesting a possible role for this gene in tumor processes. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2011]'
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.