ALDH7A1 (NM_001202404) Human Untagged Clone

CAT#: SC329643

ALDH7A1 (untagged) - Homo sapiens aldehyde dehydrogenase 7 family, member A1 (ALDH7A1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ALDH7A1
• Synonyms: ATQ1; EPD; PDE
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001202404, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGTTCTCCCGGGCGGGGGGCGGGGCTCTATTTCAGCAGCTCTCAGGGCCTTGGGCTCATCCCGAGTC
  CCGGGCTCAGTATGTGGCGCCTTCCTCGCGCGCTGTGTGTGCACGCTGCAAAGACCAGCAAGCTCTCTGG
  ACCTTGGAGCAGGCCTGCCGCCTTCATGTCCACTCTCCTCATCAATCAGCCCCAGTATGCGTGGCTGAAA
  GAGCTGGGGCTCCGCGAGGAAAACGAGGGCGTGTATAATGGAAGCTGGGGAGGCCGGGGAGAGGTTATTA
  CGACCTATTGCCCTGCTAACAACGAGCCAATAGCAAGAGTCCGACAGGCCAGTGTGGCAGACTATGAAGA
  AACTGTAAAGAAAGCAAGAGAAGCATGGAAAATCTGGGCAGATATTCCTGCTCCAAAACGAGGAGAAATA
  GTAAGACAGATTGGCGATGCCTTGCGGGAGAAGATCCAAGTACTAGGAAGCTTGGTGTCTTTGGAGATGG
  GGAAAATCTTAGTGGAAGGTGTGGGTGAAGTTCAGGAGTATGTGGATATCTGTGACTATGCTGTTGGTTT
  ATCAAGGATGATTGGAGGACCTATCTTGCCTTCTGAAAGATCTGGCCATGCACTGATTGAGCAGTGGAAT
  CCCGTAGGCCTGGTTGGAATCATCACGGCATTCAATTTCCCTGTGGCAGTGTATGGTTGGAACAACGCCA
  TCGCCATGATCTGTGGAAATGTCTGCCTCTGGAAAGGAGCTCCAACCACTTCCCTCATTAGTGTGGCTGT
  CACAAAGATAATAGCCAAGGTTCTGGAGGACAACAAGCTGCCTGGTGCAATTTGTTCCTTGACTTGTGGT
  GGAGCAGATATTGGCACAGCAATGGCCAAAGATGAACGAGTGAACCTGCTGTCCTTCACTGGGAGCACTC
  AGGTGGGAAAACAGGTGGGCCTGATGGTGCAGGAGAGGTTTGGGAGAAGTCTGTTGGAACTTGGAGGAAA
  CAATGCCATTATTGCCTTTGAAGATGCAGACCTCAGCTTAGTTGTTCCATCAGCTCTCTTCGCTGCTGTG
  GGAACAGCTGGCCAGAGGTGTACCACTGCGAGGCGACTGGTTATGGATCGCCCTGGAAATTATGTAGAAC
  CGACAATTGTGACAGGTCTTGGCCACGATGCGTCCATTGCACACACAGAGACTTTTGCTCCGATTCTCTA
  TGTCTTTAAATTCAAGAATGAAGAAGAGGTCTTTGCATGGAATAATGAAGTAAAACAGGGACTTTCAAGT
  AGCATCTTTACCAAAGATCTGGGCAGAATCTTTCGCTGGCTTGGACCTAAAGGATCAGACTGTGGCATTG
  TAAATGTCAACATTCCAACAAGTGGGGCTGAGATTGGAGGTGCCTTTGGAGGAGAAAAGCACACTGGTGG
  TGGCAGGGAGTCTGGCAGTGATGCCTGGAAACAGTACATGAGAAGGTCTACTTGTACTATCAACTACAGT
  AAAGACCTTCCTCTGGCCCAAGGAATCAAGTTTCAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001202404
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001202404.1, NP_001189333.2
• RefSeq Size: 4761 bp
• RefSeq ORF: 1509 bp
• Locus ID: 501
• Cytogenetics: 5q23.2
• Protein Families: Druggable Genome
• Protein Pathways: Arginine and proline metabolism, Ascorbate and aldarate metabolism, beta-Alanine metabolism, Butanoate metabolism, Fatty acid metabolism, Glycerolipid metabolism, Glycolysis / Gluconeogenesis, Histidine metabolism, Limonene and pinene degradation, Lysine degradation, Metabolic pathways, Propanoate metabolism, Pyruvate metabolism, Tryptophan metabolism, Valine, leucine and isoleucine degradation
• Gene Summary: 'The protein encoded by this gene is a member of subfamily 7 in the aldehyde dehydrogenase gene family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. This particular member has homology to a previously described protein from the green garden pea, the 26g pea turgor protein. It is also involved in lysine catabolism that is known to occur in the mitochondrial matrix. Recent reports show that this protein is found both in the cytosol and the mitochondria, and the two forms likely arise from the use of alternative translation initiation sites. An additional variant encoding a different isoform has also been found for this gene. Mutations in this gene are associated with pyridoxine-dependent epilepsy. Several related pseudogenes have also been identified. [provided by RefSeq, Jan 2011]'
  Transcript Variant: This variant (2) is missing two in-frame coding exons compared to variant 1, resulting in a shorter isoform (3) lacking an internal protein segment compared to isoform 1. Sequence Note: This Refseq, containing three potential in-frame translation initiation codons (all with weak Kozak signals), is annotated with a CDS starting from a downstream start codon (at nt 193-195) based on better conservation, N-terminal consistency with homologous proteins, and the presence of a transit peptide, which is essential for the localization of this isoform in the mitochondria (PMIDs: 20207735 and 19885858), and is consistent with the function of this gene in lysine catabolism (which is known to occur in the mitochondria). The use of an upstream start codon (at nt 112-114) that is present in only a subset of higher mammals, would increase the protein length by 27 aa. This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus based on the use of a downstream in-frame start codon, which is more supported by the available transcript and conservation data. There is a higher probability of an N-terminal transit peptide being present in the updated protein.