ZNF 559 (ZNF559) (NM_001202408) Human Untagged Clone

CAT#: SC329644

ZNF559 (untagged) - Homo sapiens zinc finger protein 559 (ZNF559), transcript variant 4


  "NM_001202408" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZNF559"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZNF559
Synonyms NBLA00121
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001202408, the custom clone sequence may differ by one or more nucleotides


ATGCGCATAACGGCCGCCATCTTAACAGCGCGTTCCCGTTGGCGTCTGAGGAACAGCATCTCTGCCTTCC
TGTTCACGGTGACCTTCGCTTGGTGTCCTCCTGGCCTCAGCAACCTGACAATTCTGTCGTGTCCCGATCA
TCTTTCTCAAGATGTTTTCTGTCTTCATGAGTCAAAATTTGAAGAGGAAAGGATGGTGGCTGGGTGGTTG
ACAAATTACTCTCAGGACTCAGTGACCTTTGAGGATGTGGCTGTGGACTTCACCCAGGAGGAGTGGACTT
TGCTGGATCAAACTCAGAGAAACTTATACAGAGATGTGATGCTGGAGAACTATAAGAATCTAGTTGCAGT
AGATTGGGAGAGTCATATTAATACCAAATGGTCAGCACCTCAGCAGAATTTTTTGCAGGGGAAAACATCC
AGTGTGGTGGAAATGAATTCAGAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001202408
ORF Size 447 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001202408.1, NP_001189337.1
RefSeq Size 3087
RefSeq ORF 447
Locus ID 84527
Protein Families Transcription Factors
Gene Summary May be involved in transcriptional regulation. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) uses an alternate splice site that causes a frameshift in the 3' coding region, and differs in the 3' UTR, compared to variant 1. The encoded isoform (d) has a distinct and shorter C-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.