ADK (NM_001202450) Human Untagged Clone

CAT#: SC329656

ADK (untagged) - Homo sapiens adenosine kinase (ADK), transcript variant 4


  "NM_001202450" in other vectors (2)

Reconstitution Protocol

USD 320.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ADK
Synonyms AK
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001202450, the custom clone sequence may differ by one or more nucleotides


ATGGCAGCTGCTGAGGAGGAGCCGAAGCCCAAAAAGCTGAAGGTGGAGGCGCCGCAAGCGCTGAGAGAAA
ATATTCTCTTTGGAATGGGAAATCCTCTGCTTGACATCTCTGCTGTAGTGGACAAAGATTTCCTTGATAA
GTATTCTCTGAAACCAAATGACCAAATCTTGGCTGAAGACAAACACAAGGAACTGTTTGATGAACTTGTG
AAAAAATTCAAAGTCGAATATCATGCTGGTGGCTCTACCCAGAATTCAATTAAAGTGGCTCAGTGGATGA
TTCAACAGCCACACAAAGCAGCAACATTTTTTGGATGCATTGGGATAGATAAATTTGGGGAGATCCTGAA
GAGAAAAGCTGCTGAAGCCCATGTGGATGCTCATTACTACGAGCAGAATGAGCAGCCAACAGGAACTTGT
GCTGCATGCATCACTGGTGACAACAGGTCCCTCATAGCTAATCTTGCTGCTGCCAATTGTTATAAAAAGG
AAAAACATCTTGATCTGGAGAAAAACTGGATGTTGGTAGAAAAAGCAAGAGTTTGTTATATAGCAGAAGC
TGCCACTTTTGCTAGAGAGCAAGGCTTTGAGACTAAAGACATTAAAGAGATAGCCAAAAAGACACAAGCC
CTGCCAAAGATGAACTCAAAGAGGCAGCGAATCGTGATCTTCACCCAAGGGAGAGATGACACTATAATGG
CTACAGAAAGTGAAGTCACTGCTTTTGCTGTCTTGGATCAAGACCAGAAAGAAATTATTGATACCAATGG
AGCTGGAGATGCATTTGTTGGAGGTTTTCTGTCTCAACTGGTCTCTGACAAGCCTCTGACTGAATGTATC
CGTGCTGGCCACTATGCAGCAAGCATCATAATTAGACGGACTGGCTGCACCTTTCCTGAGAAGCCAGACT
TCCACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001202450
ORF Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001202450.1, NP_001189379.1
RefSeq Size 1878
RefSeq ORF 918
Locus ID 132
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism
Gene Summary This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (4) differs in the 5' UTR, initiates translation at an alternate start codon, and lacks an alternate in-frame exon in the coding region, compared to variant 1. This results in a shorter protein (isoform d), compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.