GPBP1 (NM_001203246) Human Untagged Clone

CAT#: SC329682

GPBP1 (untagged) - Homo sapiens GC-rich promoter binding protein 1 (GPBP1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GPBP1
• Synonyms: GPBP; SSH6; VASCULIN
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001203246, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGGTCATTAAGAAAGGTAATACAAAAGACTTACAGCTATCTGGATTCCCAGTAGTAGGAAATCTTC
  CGTCACAGCCAGTTAAGAATGGAACTGGTCCAAGTGTTTATAAAGGTTTAGTCCCTAAACCTGCTGCTCC
  ACCTACAAAACCTACACAATGGAAAAGCCAAACAAAAGAAAATAAAGTTGGAACTTCTTTCCCTCATGAG
  TCCACATTTGGCGTTGGCAACTTTAATGCTTTTAAATCAACTGCCAAGAACTTTAGTCCATCTACAAATT
  CAGTGAAAGAGTGTAATCGCTCAAATTCCTCTTCTCCTGTTGACAAACTTAATCAGCAGCCTCGTCTAAC
  CAAACTGACACGAATGCGCACTGATAAGAAGAGTGAATTTTTGAAAGCATTGAAAAGAGACAGAGTAGAA
  GAGGAACATGAAGATGAAAGCCGTGCTGGCTCAGAGAAGGATGACGACTCATTTAATTTACATAACAGCA
  ATAGTACTCACCAAGAAAGGGATATAAACCGAAACTTCGATGAAAATGAAATTCCTCAAGAGAATGGCAA
  TGCCTCAGTGATTTCCCAGCAGATCATTCGGTCTTCAACCTTCCCACAAACTGATGTTCTTTCAAGTTCA
  CTTGAGGCAGAACACAGATTGTTAAAGGAAATGGGCTGGCAGGAAGACAGTGAAAATGATGAAACATGTG
  CTCCCTTAACTGAGGATGAAATGAGAGAATTCCAAGTTATTAGTGAACAGTTACAGAAGAATGGTCTGAG
  AAAAAATGGTATTTTGAAAAATGGCTTGATCTGTGACTTCAAGTTTGGACCGTGGAAGAACAGCACTTTC
  AAACCCACAACTGAGAATGATGACACAGAGACAAGTAGCAGTGATACATCAGATGACGACGATGTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001203246
• ORF Size: 909 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001203246.1, NP_001190175.1
• RefSeq Size: 4520
• RefSeq ORF: 909
• Locus ID: 65056
• Gene Summary: This gene was originally isolated by subtractive hybridization of cDNAs expressed in atherosclerotic plaques with a thrombus, and was found to be expressed only in vascular smooth muscle cells. However, a shorter splice variant was found to be more ubiquitously expressed. This protein is suggested to play a role in the development of atherosclerosis. Studies in mice suggest that it may also function as a GC-rich promoter-specific trans-activating transcription factor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (4) is missing an exon in the 5' region compared to variant 1. This results in translation initiation from an in-frame downstream AUG, and a much shorter isoform (4, also known as SSH6-beta) compared to isoform 1. This isoform has been reported to be more ubiquitously expressed compared to the vascular wall specific expression pattern of the longer isoforms (PMID:12842993).