NDUFC2 (NM_001204055) Human Untagged Clone

CAT#: SC329688

NDUFC2 (untagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa (NDUFC2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NDUFC2
• Synonyms: B14.5b; CI-B14.5b; HLC-1; NADHDH2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204055, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATCGCACGGCGGAACCCAGAACCCTTACGGTTTCTGCCGGATGAGGCCCGGAGCCTGCCCCCGCCCA
  AGCTGACCGACCCGCGGCTCCTCTACATCGGCTTCTTGGGCTACTGCTCCGGCCTGATTGATAACCTAAT
  CCGGCGGAGGCCGATCGCGACGGCTGACTACCTGTATGCTGTGAGGGACCGTGAAATGTTTGGATATATG
  AAATTACATCCAGAGGATTTTCCTGAAGAAGATAAGAAAACATATGGTGAAATTTTTGAAAAATTCCATC
  CAATACGTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204055
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001204055.1, NP_001190984.1
• RefSeq Size: 2422 bp
• RefSeq ORF: 291 bp
• Locus ID: 4718
• Cytogenetics: 11q14.1
• Protein Families: Transmembrane
• Protein Pathways: Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• Gene Summary: ''
  Transcript Variant: This variant (3) uses an alternate splice sites in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 3, which has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.