COX16 (NM_001204090) Human Untagged Clone

CAT#: SC329702

COX16 (untagged) - Homo sapiens COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX16), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COX16
• Synonyms: C14orf112; hCOX16; HSPC203
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204090, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTTGCACCCGCGGTGATGCGTGCTTTTCGCAAGAACAAGACTCTCGGCTATGGAGTCCCCATGTTGA
  TGGATCCTGAGCTTGAAAAAAAACTGAAAGAGAATAAAATATCTTTAGAGTCGGAATATGAGAAAATCAA
  AGACTCCAAGTTTGATGACTGGAAGAATATTCGAGGACCCAGGCCTTGGGAAGATCCTGACCTCCTCCAA
  GGAAGAAATCCAGAAAGCCTTAAGACTAAGACAACTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204090
• ORF Size: 249 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001204090.1, NP_001191019.1
• RefSeq Size: 1652
• RefSeq ORF: 249
• Locus ID: 51241
• Protein Families: Secreted Protein, Transmembrane