PREI3 (MOB4) (NM_001204094) Human Untagged Clone

CAT#: SC329704

MOB4 (untagged) - Homo sapiens MOB family member 4, phocein (MOB4), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MOB4
• Synonyms: 2C4D; CGI-95; MOB1; MOB3; MOBKL3; PHOCN; PREI3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204094, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACAGTACACTAGCTGTTCAACAGTATATTCAACAGAACATAAGAGCAGATTGCTCCAATATTGACA
  AAATTCTTGAACCACCTGAAGGCCAAGATGAAGGTGTGTGGAAGTATGAACATTTAAGGCAGTTCTGCCT
  TGAGCTAAATGGACTTGCTGTCAAACTTCAGAGTGAATGCCATCCAGATACTTGCACTCAAATGACAGCA
  ACTGAACAATGGATTTTTCTTTGTGCAGCTCATAAAACTCCAAAAGAGTGTCCTGCTATAGACTATACTA
  GACACACACTTGATGGTGCTGCATGTCTTCTGAATAGCAATAAATATTTTCCCAGCAGGGTTAGCATAAA
  GGAATCATCTGTAGCGAAACTAGGATCAGTATGCCGTAGGATTTACAGAATATTTTCACATGCTTATTTT
  CATCATCGGCAGATATTTGATGAATATGAAAATGAAACATTTTTGTGTCATCGGTTTACTAAGTTTGTGA
  TGAAATACAATTTGATGTCCAAGGATAACCTGATTGTACCAATTTTAGAAGAGGAAGTACAGAATTCAGT
  TTCTGGGGAAAGTGAAGCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204094
• ORF Size: 582 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001204094.1, NP_001191023.1
• RefSeq Size: 3742
• RefSeq ORF: 582
• Locus ID: 25843
• Gene Summary: This gene was identified based on its similarity with the mouse counterpart. Studies of the mouse counterpart suggest that the expression of this gene may be regulated during oocyte maturation and preimplantation following zygotic gene activation. Alternatively spliced transcript variants encoding distinct isoforms have been observed. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HSPE1. [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (4) uses an alternate exon at its 5' end compared to variant 1, resulting in a different 5' UTR and translation initiation at a downstream start codon. The resulting isoform (2) has a shorter N-terminus compared to isoform 1. Variants 2 and 4 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.