Bim (BCL2L11) (NM_001204107) Human Untagged Clone
CAT#: SC329708
BCL2L11 (untagged) - Homo sapiens BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 12
"NM_001204107" in other vectors (2)
Product Images
Other products for "BCL2L11"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BCL2L11 |
Synonyms | BAM; BIM; BOD |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001204107, the custom clone sequence may differ by one or more nucleotides
ATGGCAAAGCAACCTTCTGATGTAAGTTCTGAGTGTGACCGAGAAGGTAGACAATTGCAGCCTGCGGAGA GGCCTCCCCAGCTCAGACCTGGGGCCCCTACCTCCCTACAGACAGAGCCACAAGCTTCCATGAGGCAGGC TGAACCTGCAGATATGCGCCCAGAGATATGGATCGCCCAAGAGTTGCGGCGTATTGGAGACGAGTTTAAC GCTTACTATGCAAGGAGGCTGGCAAAACTCCTGGCATCCTCCACCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204107 |
ORF Size | 258 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001204107.1, NP_001191036.1 |
RefSeq Size | 5033 |
RefSeq ORF | 258 |
Locus ID | 10018 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains a Bcl-2 homology domain 3 (BH3). It has been shown to interact with other members of the BCL-2 protein family and to act as an apoptotic activator. The expression of this gene can be induced by nerve growth factor (NGF), as well as by the forkhead transcription factor FKHR-L1, which suggests a role of this gene in neuronal and lymphocyte apoptosis. Transgenic studies of the mouse counterpart suggested that this gene functions as an essential initiator of apoptosis in thymocyte-negative selection. Several alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (12) uses an alternate in-frame splice site in the 5' coding region, contains two alternate internal exons, and differs in the 3' coding region and UTR, compared to variant 1. The resulting isoform (12) is shorter and has a distinct C-terminus, compared to isoform 1. This record was created to support clinical studies, but the encoded isoform currently lacks experimental evidence. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.