Bim (BCL2L11) (NM_001204112) Human Untagged Clone

CAT#: SC329713

BCL2L11 (untagged) - Homo sapiens BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 17


  "NM_001204112" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "BCL2L11"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BCL2L11
Synonyms BAM; BIM; BOD
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001204112, the custom clone sequence may differ by one or more nucleotides


ATGGCAAAGCAACCTTCTGATGTAAGTTCTGAGTGTGACCGAGAAGGTAGACAATTGCAGCCTGCGGAGA
GGCCTCCCCAGCTCAGACCTGGGGCCCCTACCTCCCTACAGACAGAGCCACAAGACAGGAGCCCAGCACC
CATGAGTTGTGACAAATCAACACAAACCCCAAGTCCTCCTTGCCAGGCCTTCAACCACTATCTCAGTGCA
ATGGTTAGAGAAATAGAGGAAGTTGTCGTGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001204112
ORF Size 243 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001204112.1, NP_001191041.1
RefSeq Size 4947
RefSeq ORF 243
Locus ID 10018
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains a Bcl-2 homology domain 3 (BH3). It has been shown to interact with other members of the BCL-2 protein family and to act as an apoptotic activator. The expression of this gene can be induced by nerve growth factor (NGF), as well as by the forkhead transcription factor FKHR-L1, which suggests a role of this gene in neuronal and lymphocyte apoptosis. Transgenic studies of the mouse counterpart suggested that this gene functions as an essential initiator of apoptosis in thymocyte-negative selection. Several alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (17) lacks an alternate in-frame segment in the 5' coding region, lacks an internal exon, and contains an alternate internal exon, compared to variant 1. The resulting isoform (17) is shorter and has a distinct C-terminus, compared to isoform 1. This record was created to support clinical studies, but the encoded isoform currently lacks experimental evidence. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.