MGST2 (NM_001204366) Human Untagged Clone
CAT#: SC329740
MGST2 (untagged) - Homo sapiens microsomal glutathione S-transferase 2 (MGST2), transcript variant 2
"NM_001204366" in other vectors (2)
Product Images
Other products for "MGST2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MGST2 |
Synonyms | GST2; MGST-II |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001204366, the custom clone sequence may differ by one or more nucleotides
ATGGCCGGGAACTCGATCCTGCTGGCTGCTGTCTCTATTCTCTCGGCCTGTCAGCAAAGTTATTTTGCTT TGCAAGTTGGAAAGGCAAGATTAAAATACAAAGTTACGCCCCCAGCAGTCACTGGGTCACCAGAGTTTGA GAGAGTATTTCGGGCACAACAAAACTGTGTGGAGTTTTATCCTATATTCATAATTACATTGTGGATGGCT GGGTGGTATTTCAACCAAGTTTTTGCTACTTGTCTGGGTCTGGTGTACATATATGGCCGTCACCTATACT TCTGGGGATATTCAGAAGCTGCTAAAAAACGGATCACCGGTTTCCGACTGAGTCTGGGGATTTTGGCCTT GTTGACCCTCCTAGGTGCCCTGGGAATTGCAAACAGCTTTCTGGATGAATATCTGGACCTCAATATTGCC AAGAAACTGAGGCGGCAATTCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204366 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001204366.1, NP_001191295.1 |
RefSeq Size | 1278 bp |
RefSeq ORF | 444 bp |
Locus ID | 4258 |
Cytogenetics | 4q31.1 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450 |
Gene Summary | 'The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, several of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. This gene encodes a protein which catalyzes the conjugation of leukotriene A4 and reduced glutathione to produce leukotriene C4. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2011]' Transcript Variant: This variant (2) has an alternate 3' UTR and encodes the same isoform (1), as compared to variant 1. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.