XIAP (NM_001204401) Human Untagged Clone

CAT#: SC329750

XIAP (untagged) - Homo sapiens X-linked inhibitor of apoptosis (XIAP), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: XIAP
• Synonyms: API3; BIRC4; hIAP-3; hIAP3; IAP-3; ILP1; MIHA; XLP2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204401, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACTTTTAACAGTTTTGAAGGATCTAAAACTTGTGTACCTGCAGACATCAATAAGGAAGAAGAATTTG
  TAGAAGAGTTTAATAGATTAAAAACTTTTGCTAATTTTCCAAGTGGTAGTCCTGTTTCAGCATCAACACT
  GGCACGAGCAGGGTTTCTTTATACTGGTGAAGGAGATACCGTGCGGTGCTTTAGTTGTCATGCAGCTGTA
  GATAGATGGCAATATGGAGACTCAGCAGTTGGAAGACACAGGAAAGTATCCCCAAATTGCAGATTTATCA
  ACGGCTTTTATCTTGAAAATAGTGCCACGCAGTCTACAAATTCTGGTATCCAGAATGGTCAGTACAAAGT
  TGAAAACTATCTGGGAAGCAGAGATCATTTTGCCTTAGACAGGCCATCTGAGACACATGCAGACTATCTT
  TTGAGAACTGGGCAGGTTGTAGATATATCAGACACCATATACCCGAGGAACCCTGCCATGTATAGTGAAG
  AAGCTAGATTAAAGTCCTTTCAGAACTGGCCAGACTATGCTCACCTAACCCCAAGAGAGTTAGCAAGTGC
  TGGACTCTACTACACAGGTATTGGTGACCAAGTGCAGTGCTTTTGTTGTGGTGGAAAACTGAAAAATTGG
  GAACCTTGTGATCGTGCCTGGTCAGAACACAGGCGACACTTTCCTAATTGCTTCTTTGTTTTGGGCCGGA
  ATCTTAATATTCGAAGTGAATCTGATGCTGTGAGTTCTGATAGGAATTTCCCAAATTCAACAAATCTTCC
  AAGAAATCCATCCATGGCAGATTATGAAGCACGGATCTTTACTTTTGGGACATGGATATACTCAGTTAAC
  AAGGAGCAGCTTGCAAGAGCTGGATTTTATGCTTTAGGTGAAGGTGATAAAGTAAAGTGCTTTCACTGTG
  GAGGAGGGCTAACTGATTGGAAGCCCAGTGAAGACCCTTGGGAACAACATGCTAAATGGTATCCAGGGTG
  CAAATATCTGTTAGAACAGAAGGGACAAGAATATATAAACAATATTCATTTAACTCATTCACTTGAGGAG
  TGTCTGGTAAGAACTACTGAGAAAACACCATCACTAACTAGAAGAATTGATGATACCATCTTCCAAAATC
  CTATGGTACAAGAAGCTATACGAATGGGGTTCAGTTTCAAGGACATTAAGAAAATAATGGAGGAAAAAAT
  TCAGATATCTGGGAGCAACTATAAATCACTTGAGGTTCTGGTTGCAGATCTAGTGAATGCTCAGAAAGAC
  AGTATGCAAGATGAGTCAAGTCAGACTTCATTACAGAAAGAGATTAGTACTGAAGAGCAGCTAAGGCGCC
  TGCAAGAGGAGAAGCTTTGCAAAATCTGTATGGATAGAAATATTGCTATCGTTTTTGTTCCTTGTGGACA
  TCTAGTCACTTGTAAACAATGTGCTGAAGCAGTTGACAAGTGTCCCATGTGCTACACAGTCATTACTTTC
  AAGCAAAAAATTTTTATGTCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204401
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001204401.1, NP_001191330.1
• RefSeq Size: 8427 bp
• RefSeq ORF: 1494 bp
• Locus ID: 331
• Cytogenetics: Xq25
• Protein Families: Druggable Genome
• Protein Pathways: Apoptosis, Focal adhesion, NOD-like receptor signaling pathway, Pathways in cancer, Small cell lung cancer, Ubiquitin mediated proteolysis
• Gene Summary: 'This gene encodes a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. This protein functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. This protein also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 2 and 11.[provided by RefSeq, Feb 2011]'
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.