TROY (TNFRSF19) (NM_001204459) Human Untagged Clone

CAT#: SC329757

TNFRSF19 (untagged) - Homo sapiens tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), transcript variant 4


  "NM_001204459" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TNFRSF19"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TNFRSF19
Synonyms TAJ; TAJ-alpha; TRADE; TROY
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001204459, the custom clone sequence may differ by one or more nucleotides


ATGGAGTGTGTGCCTTGTGGAGACCCTCCTCCTCCTTACGAACCGCACTGTGCCAGCAAGGTCAACCTCG
TGAAGATCGCGTCCACGGCCTCCAGCCCACGGGACACGGCGCTGGCTGCCGTTATCTGCAGCGCTCTGGC
CACCGTCCTGCTGGCCCTGCTCATCCTCTGTGTCATCTATTGTAAGAGACAGTTTATGGAGAAGAAACCC
AGCTGGTCTCTGCGGTCACAGGACATTCAGTACAACGGCTCTGAGCTGTCGTGTTTTGACAGACCTCAGC
TCCACGAATATGCCCACAGAGCCTGCTGCCAGTGCCGCCGTGACTCAGTGCAGACCTGCGGGCCGGTGCG
CTTGCTCCCATCCATGTGCTGTGAGGAGGCCTGCAGCCCCAACCCGGCGACTCTTGGTTGTGGGGTGCAT
TCTGCAGCCAGTCTTCAGGCAAGAAACGCAGGCCCAGCCGGGGAGATGGTGCCGACTTTCTTCGGATCCC
TCACGCAGTCCATCTGTGGCGAGTTTTCAGATGCCTGGCCTCTGATGCAGAATCCCATGGGTGGTGACAA
CATCTCTTTTTGTGACTCTTATCCTGAACTCACTGGAGAAGACATTCATTCTCTCAATCCAGAACTTGAA
AGCTCAACGTCTTTGGATTCAAATAGCAGTCAAGATTTGGTTGGTGGGGCTGTTCCAGTCCAGTCTCATT
CTGAAAACTTTACAGCAGCTACTGATTTATCTAGATATAACAACACACTGGTAGAATCAGCATCAACTCA
GGATGCACTAACTATGAGAAGCCAGCTAGATCAGGAGAGTGGTGCTGTCATCCACCCAGCCACTCAGACG
TCCCTCCAGGAAGCTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001204459
ORF Size 858 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001204459.1, NP_001191388.1
RefSeq Size 4309
RefSeq ORF 858
Locus ID 55504
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction
Gene Summary The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is highly expressed during embryonic development. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. This receptor is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in both UTR's and the 3' coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (4) with a shorter N-terminus and a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.