TAX1BP3 (NM_001204698) Human Untagged Clone

CAT#: SC329763

TAX1BP3 (untagged) - Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 3 (TAX1BP3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TAX1BP3
• Synonyms: TIP-1; TIP1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204698, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCTACATCCCGGGCCAGCCGGTCACCGCCGTGGTGCAAAGAGTTGAAATTCACAAGCTGCGTCAAG
  GTGAGAACTTAATCCTGGGTTTCAGCATTGGAGGTGGAATCGACCAGGATCCTTCCCAGAATCCCTTCTC
  TGAAGACAAGACGGACAAGGTGAACGGCTGGGACATGACCATGGTCACACACGACCAGGCCCGCAAGCGG
  CTCACCAAGCGCTCGGAGGAGGTGGTGCGTCTGCTGGTGACGCGGCAGTCGCTGCAGAAGGCCGTGCAGC
  AGTCCATGCTGTCCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204698
• ORF Size: 297 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001204698.1, NP_001191627.1
• RefSeq Size: 1320
• RefSeq ORF: 297
• Locus ID: 30851
• Gene Summary: This gene encodes a small, highly conserved protein with a single PDZ domain. PDZ (PSD-95/Discs large/ZO-1 homologous) domains promote protein-protein interactions that affect cell signaling, adhesion, protein scaffolding, and receptor and ion transporter functions. The encoded protein interacts with a large number of target proteins that play roles in signaling pathways; for example, it interacts with Rho A and glutaminase L and also acts as a negative regulator of the Wnt/beta-catenin signaling pathway. This protein was first identified as binding to the T-cell leukaemia virus (HTLV1) Tax oncoprotein. Overexpression of this gene has been implicated in altered cancer cell adhesion, migration and metastasis. The encoded protein also modulates the localization and density of inwardly rectifying potassium channel 2.3 (Kir2.3). To date, this protein has been shown to play a role in cell proliferation, development, stress response, and polarization. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Apr 2017]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1.