ELOC (NM_001204859) Human Untagged Clone

CAT#: SC329773

TCEB1 (untagged) - Homo sapiens transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) (TCEB1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ELOC
• Synonyms: SIII; TCEB1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204859, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAATTGATATCAT
  CTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGCACGATAAAAGCCATGTTGAG
  TGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTCAATTTTAGAGAGATACCTTCACATGTGCTA
  TCGAAAGTATGCATGTATTTTACGTACAAGGTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCC
  CAATTGCACCTGAAATTGCACTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204859
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001204859.1, NP_001191788.1
• RefSeq Size: 2231 bp
• RefSeq ORF: 339 bp
• Locus ID: 6921
• Cytogenetics: 8q21.11
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Pathways in cancer, Renal cell carcinoma, Ubiquitin mediated proteolysis
• Gene Summary: 'This gene encodes the protein elongin C, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been identified. [provided by RefSeq, Mar 2011]'
  Transcript Variant: This variant (4) includes an alternate exon in the 5' UTR compared to variant 1. Variants 1-7 encode the same protein (isoform a).