Occludin (OCLN) (NM_001205255) Human Untagged Clone

CAT#: SC329791

OCLN (untagged) - Homo sapiens occludin (OCLN), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OCLN
• Synonyms: BLCPMG; PPP1R115; PTORCH1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001205255, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATTATTGTGGCTTTTGCTTTAATAATTTTCTTTGCTGTGAAAACTCGAAGAAAGATGGACAGGTATG
  ACAAGTCCAATATTTTGTGGGACAAGGAACACATTTATGATGAGCAGCCCCCCAATGTCGAGGAGTGGGT
  TAAAAATGTGTCTGCAGGCACACAGGACGTGCCTTCACCCCCATCTGACTATGTGGAAAGAGTTGACAGT
  CCCATGGCATACTCTTCCAATGGCAAAGTGAATGACAAGCGGTTTTATCCAGAGTCTTCCTATAAATCCA
  CGCCGGTTCCTGAAGTGGTTCAGGAGCTTCCATTAACTTCGCCTGTGGATGACTTCAGGCAGCCTCGTTA
  CAGCAGCGGTGGTAACTTTGAGACACCTTCAAAAAGAGCACCTGCAAAGGGAAGAGCAGGAAGGTCAAAG
  AGAACAGAGCAAGATCACTATGAGACAGACTACACAACTGGCGGCGAGTCCTGTGATGAGCTGGAGGAGG
  ACTGGATCAGGGAATATCCACCTATCACTTCAGATCAACAAAGACAACTGTACAAGAGGAATTTTGACAC
  TGGCCTACAGGAATACAAGAGCTTACAATCAGAACTTGATGAGATCAATAAAGAACTCTCCCGTTTGGAT
  AAAGAATTGGATGACTATAGAGAAGAAAGTGAAGAGTACATGGCTGCTGCTGATGAATACAATAGACTGA
  AGCAAGTGAAGGGATCTGCAGATTACAAAAGTAAGAAGAATCATTGCAAGCAGTTAAAGAGCAAATTGTC
  ACACATCAAGAAGATGGTTGGAGACTATGATAGACAGAAAACATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001205255
• ORF Size: 816 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001205255.1, NP_001192184.1
• RefSeq Size: 5404
• RefSeq ORF: 816
• Locus ID: 100506658
• Gene Summary: This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5. [provided by RefSeq, Apr 2011]
  Transcript Variant: This variant (3) lacks a portion of the 5' coding region and uses a downstream start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. The 5' UTR of this variant is incomplete due to a lack of 5'-complete transcripts containing this exon combination and the presence of splicing ambiguity at the 5' end. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.