IGSF23 (NM_001205280) Human Untagged Clone

CAT#: SC329800

IGSF23 (untagged) - Homo sapiens immunoglobulin superfamily, member 23 (IGSF23)


  "NM_001205280" in other vectors (2)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "IGSF23"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IGSF23
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001205280, the custom clone sequence may differ by one or more nucleotides


ATGAGAGCAAAACCTCAGAGCCCCCTTCCCAGGAACCCTGTCCCAGCCTGGTCCCCACCCACCACCACCA
CTGACCCGATGCTAGAGAAGGATGCGGCTGGAGGTGACTTCCCAGCCAACTTGGTCCTCCAACTAATGCC
ACTGAAGACATTCCCAGCTGCTATCCGGGGAGTCATCCAGAGTGAGCTCAACTATTCTGTGATCCTGCAG
TGGGTGGTGACAATGGACCCTGAGCCTGTGCTGAGCTGGACCTTCAGTGGGGTGCCCTGTGGGATGGGAG
AGAAGCTGTTCATCCGACGGTTGTCCTGTGAGCAGCTGGGCACCTACATGTGCATAGCCACAAACAGCAA
GAAACAGCTGGTCTCTGAGCCTGTAACCATCTCGCTGCCAAAACCCATCATGCAGCCCACAGAAGCAGAG
CCCATGGAGCCAGACCCCACTCTGTCCCTGTCAGGAGGCTCTGCCATCGGGCTCCTTGCGGCTGGGATCC
TGGGAGCCGGGGCACTGATTGCAGGCATGTGTTTCATCATCATCCAGAGCCTAAGGACTGACAGGCAGAG
AATAGGAATATGCAGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001205280
ORF Size 579 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_001205280.1, NP_001192209.1
RefSeq Size 1001
RefSeq ORF 579
Locus ID 147710
Protein Families Transmembrane
Gene Summary This gene encodes a protein that has one immunoglobulin (Ig) domain and is a member of the immunoglobulin superfamily. Proteins in this superfamily are usually found on or in cell membranes and act as receptors in immune response pathways. [provided by RefSeq, Nov 2011]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.