ATP5MD (NM_001206426) Human Untagged Clone

CAT#: SC329807

USMG5 (untagged) - Homo sapiens up-regulated during skeletal muscle growth 5 homolog (mouse) (USMG5), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP5MD
• Synonyms: bA792D24.4; DAPIT; HCVFTP2; USMG5
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001206426, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAGGTCCAGAAAGTGATGCGCAATACCAGTTCACTGGTATTAAAAAATATTTCAACTCTTATACTC
  TCACAGGTAGAATGAACTGTGTACTGGCCACATATGGAAGCATTGCATTGATTGTCTTATATTTCAAGTT
  AAGGTCCAAAAAAACTCCAGCTGTGAAAGCAACATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206426
• ORF Size: 177 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_001206426.1, NP_001193355.1
• RefSeq Size: 427
• RefSeq ORF: 177
• Locus ID: 84833
• Protein Families: Transmembrane