ATF3 (NM_001206484) Human Untagged Clone
CAT#: SC329811
ATF3 (untagged) - Homo sapiens activating transcription factor 3 (ATF3), transcript variant 5
"NM_001206484" in other vectors (2)
Product Images
Other products for "ATF3"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATF3 |
Synonyms | FLJ41705 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001206484, the custom clone sequence may differ by one or more nucleotides
ATGTCCTCTGCGCTGGAATCAGTCACTGTCAGCGACAGACCCCTCGGGGTGTCCATCACAAAAGCCGAGG TAGCCCCTGAAGAAGATGAAAGGAAAAAGAGGCGACGAGAAAGAAATAAGATTGCAGCTGCAAAGTGCCG AAACAAGAAGAAGGAGAAGACGGAGTGCCTGCAGAAAGAGTCGGAGAAGCTGGAAAGTGTGAATGCTGAA CTGAAGGCTCAGATTGAGGAGCTCAAGAACGAGAAGCAGCATTTGATATACATGCTCAACCTTCATCGGC CCACGTGTATTGTCCGGGCTCAGAATGGGAGGACTCCAGAAGATGAGAGAAACCTCTTTATCCAACAGAT AAAAGAAGGAACATTGCAGAGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206484 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001206484.2, NP_001193413.2 |
RefSeq Size | 2048 bp |
RefSeq ORF | 375 bp |
Locus ID | 467 |
Cytogenetics | 1q32.3 |
Protein Families | Transcription Factors |
Gene Summary | 'This gene encodes a member of the mammalian activation transcription factor/cAMP responsive element-binding (CREB) protein family of transcription factors. This gene is induced by a variety of signals, including many of those encountered by cancer cells, and is involved in the complex process of cellular stress response. Multiple transcript variants encoding different isoforms have been found for this gene. It is possible that alternative splicing of this gene may be physiologically important in the regulation of target genes. [provided by RefSeq, Apr 2011]' Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (3) is shorter at the N-terminus, compared to isoform 1. Both variants 5 and 8 encode isoform 3. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.