POLR1D (NM_001206559) Human Untagged Clone

CAT#: SC329817

POLR1D (untagged) - Homo sapiens polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: POLR1D
• Synonyms: AC19; POLR1C; RPA9; RPA16; RPAC2; RPC16; RPO1-3; TCS2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001206559, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGACCCATGGGTTGGATGAAGTGTCCTCTTGCTAGCACCAATAAAAGATTTCTAATTAACACAATTA
  AAAACACATTGCCCTCTCATAAAGAGCAAGACCATGAACAAAAAGAGGGCGATAAGGAACCAGCGAAGAG
  CCAGGCCCAGAAAGAAGAAAACCCGAAGAAACACAGAAGCCATCCTTACAAGCACAGCTTCCGCGCTCGA
  GGTTCCGCCAGTTACTCCCCGCCACGAAAGCGGAGCAGCCAGGACAAGTACGAAAAGCGGTCCAACCGGC
  GGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206559
• ORF Size: 285 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001206559.1, NP_001193488.1
• RefSeq Size: 2210
• RefSeq ORF: 285
• Locus ID: 51082
• Protein Families: Stem cell - Pluripotency, Transcription Factors
• Protein Pathways: Cytosolic DNA-sensing pathway, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
• Gene Summary: The protein encoded by this gene is a component of the RNA polymerase I and RNA polymerase III complexes, which function in the synthesis of ribosomal RNA precursors and small RNAs, respectively. Mutations in this gene are a cause of Treacher Collins syndrome (TCS), a craniofacial development disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2011]
  Transcript Variant: This variant (3) differs in both UTRs and in the coding region, compared to variant 1. The encoded isoform (3) shares identity with isoform 2 but is distinct and shorter, compared to isoform 1.