Bif (SH3GLB1) (NM_001206653) Human Untagged Clone

CAT#: SC329826

SH3GLB1 (untagged) - Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 4


  "NM_001206653" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SH3GLB1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SH3GLB1
Synonyms Bif-1; CGI-61; dJ612B15.2; PPP1R70
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001206653, the custom clone sequence may differ by one or more nucleotides


ATGATTGATGCAGGGACTGAGTTTGGCCCAGGAACAGCTTATGGTAATGCCCTTATTAAATGTGGAGAAA
CCCAAAAAAGAATTGGAACAGCAGACAGAGAACTGATTCAAACGTCAGCCTTAAATTTTCTTACTCCTTT
AAGAAACTTTATAGAAGGAGATTACAAAACAATTGCTAAAGAAAGGAAACTATTGCAAAATAAGAGACTG
GATTTGGATGCTGCAAAAACGAGACTAAAAAAGGCAAAAGCTGCAGAAACTAGAAATTCATCTGAACAGG
AATTAAGAATAACTCAAAGTGAATTTGATCGTCAAGCAGAGATTACCAGACTTCTGCTAGAGGGAATCAG
CAGTACACATGCCCATCACCTTCGCTGTCTGAATGACTTTGTAGAAGCCCAGATGACTTACTATGCACAG
TGTTACCAGTATATGTTGGACCTCCAGAAACAACTGGGAAGTTTTCCATCCAATTATCTTAGTAACAACA
ATCAGACTTCTGTGACACCTGTACCATCAGTTTTACCAAATGCGATTGGTTCTTCTGCCATGGCTTCAAC
AAGTGGCCTAGTAATCACCTCTCCTTCCAACCTCAGTGACCTTAAGGAGTGTAGTGGCAGCAGAAAGGCC
AGGGTTCTCTATGATTATGATGCAGCAAACAGTACTGAATTATCACTTCTGGCAGATGAGGTGATCACTG
TGTTCAGTGTTGTTGGAATGGATTCAGACTGGCTAATGGGGGAAAGGGGAAACCAGAAGGGCAAGGTGCC
AATTACCTACTTAGAACTGCTCAATTAA


Restriction Sites SgfI-MluI     
ACCN NM_001206653
ORF Size 798 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001206653.1, NP_001193582.1
RefSeq Size 6240
RefSeq ORF 798
Locus ID 51100
Protein Pathways Endocytosis
Gene Summary This gene encodes a SRC homology 3 domain-containing protein. The encoded protein interacts with the proapoptotic member of the Bcl-2 family, Bcl-2-associated X protein (Bax) and may be involved in regulating apoptotic signaling pathways. This protein may also be involved in maintaining mitochondrial morphology. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (4) lacks an exon in the 5' region, resulting in a downstream AUG start codon, compared to variant 1. The resulting isoform (4) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.