Bif (SH3GLB1) (NM_001206653) Human Untagged Clone
CAT#: SC329826
SH3GLB1 (untagged) - Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 4
"NM_001206653" in other vectors (2)
Product Images
Other products for "SH3GLB1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SH3GLB1 |
Synonyms | Bif-1; CGI-61; dJ612B15.2; PPP1R70 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001206653, the custom clone sequence may differ by one or more nucleotides
ATGATTGATGCAGGGACTGAGTTTGGCCCAGGAACAGCTTATGGTAATGCCCTTATTAAATGTGGAGAAA CCCAAAAAAGAATTGGAACAGCAGACAGAGAACTGATTCAAACGTCAGCCTTAAATTTTCTTACTCCTTT AAGAAACTTTATAGAAGGAGATTACAAAACAATTGCTAAAGAAAGGAAACTATTGCAAAATAAGAGACTG GATTTGGATGCTGCAAAAACGAGACTAAAAAAGGCAAAAGCTGCAGAAACTAGAAATTCATCTGAACAGG AATTAAGAATAACTCAAAGTGAATTTGATCGTCAAGCAGAGATTACCAGACTTCTGCTAGAGGGAATCAG CAGTACACATGCCCATCACCTTCGCTGTCTGAATGACTTTGTAGAAGCCCAGATGACTTACTATGCACAG TGTTACCAGTATATGTTGGACCTCCAGAAACAACTGGGAAGTTTTCCATCCAATTATCTTAGTAACAACA ATCAGACTTCTGTGACACCTGTACCATCAGTTTTACCAAATGCGATTGGTTCTTCTGCCATGGCTTCAAC AAGTGGCCTAGTAATCACCTCTCCTTCCAACCTCAGTGACCTTAAGGAGTGTAGTGGCAGCAGAAAGGCC AGGGTTCTCTATGATTATGATGCAGCAAACAGTACTGAATTATCACTTCTGGCAGATGAGGTGATCACTG TGTTCAGTGTTGTTGGAATGGATTCAGACTGGCTAATGGGGGAAAGGGGAAACCAGAAGGGCAAGGTGCC AATTACCTACTTAGAACTGCTCAATTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206653 |
ORF Size | 798 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001206653.1, NP_001193582.1 |
RefSeq Size | 6240 |
RefSeq ORF | 798 |
Locus ID | 51100 |
Protein Pathways | Endocytosis |
Gene Summary | This gene encodes a SRC homology 3 domain-containing protein. The encoded protein interacts with the proapoptotic member of the Bcl-2 family, Bcl-2-associated X protein (Bax) and may be involved in regulating apoptotic signaling pathways. This protein may also be involved in maintaining mitochondrial morphology. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (4) lacks an exon in the 5' region, resulting in a downstream AUG start codon, compared to variant 1. The resulting isoform (4) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.