AMPK gamma 1 (PRKAG1) (NM_001206710) Human Untagged Clone
CAT#: SC329832
PRKAG1 (untagged) - Homo sapiens protein kinase, AMP-activated, gamma 1 non-catalytic subunit (PRKAG1), transcript variant 4
"NM_001206710" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PRKAG1 |
Synonyms | AMPKG |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001206710, the custom clone sequence may differ by one or more nucleotides
ATGAAGTCTCATCGCTGCTATGACCTGATTCCCACAAGCTCCAAATTGGTTGTATTTGATACGTCCCTGC AGGTGAAGAAAGCTTTTTTTGCTTTGGTGACTAACGGTGTACGAGCTGCCCCTTTATGGGATAGTAAGAA GCAAAGTTTTGTGGGCATGCTGACCATCACTGATTTCATCAATATCCTGCACCGCTACTATAAATCAGCC TTGGTACAGATCTATGAGCTAGAAGAACACAAGATAGAAACTTGGAGAGAGGTGTATCTCCAGGACTCCT TTAAACCGCTTGTCTGCATTTCTCCTAATGCCAGCTTGTTTGATGCTGTCTCTTCATTAATTCGGAACAA GATCCACAGGCTGCCAGTTATTGACCCAGAATCAGGCAATACTTTGTACATCCTCACCCACAAGCGCATT CTGAAGTTCCTCAAATTGTTTATCACTGAGTTCCCCAAGCCAGAGTTCATGTCCAAGTCTCTGGAAGAGC TACAGATTGGCACCTATGCCAATATTGCTATGGTTCGCACTACCACCCCCGTCTATGTGGCTCTGGGGAT TTTTGTACAGCATCGAGTCTCAGCCCTGCCAGTGGTGGATGAGAAGGGGCGTGTGGTGGACATCTACTCC AAGTTTGATGTTATCAATCTGGCAGCAGAAAAGACCTACAACAACCTAGATGTATCTGTGACTAAAGCCT TGCAACATCGATCACATTACTTTGAGGGTGTTCTCAAGTGCTACCTGCATGAGACTCTGGAGACCATCAT CAACAGGCTAGTGGAAGCAGAGGTTCACCGACTTGTAGTGGTGGATGAAAATGATGTGGTCAAGGGAATT GTATCACTGTCTGACATCCTGCAGGCCCTGGTGCTCACAGGTGGAGAGAAGAAGCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206710 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001206710.1, NP_001193639.1 |
RefSeq Size | 1854 bp |
RefSeq ORF | 900 bp |
Locus ID | 5571 |
Cytogenetics | 12q13.12 |
Protein Families | Druggable Genome |
Protein Pathways | Adipocytokine signaling pathway, Hypertrophic cardiomyopathy (HCM), Insulin signaling pathway |
Gene Summary | 'The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (4) differs in the 5' UTR and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (4) is shorter at the N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232409 | PRKAG1 (Myc-DDK tagged) - Homo sapiens protein kinase, AMP-activated, gamma 1 non-catalytic subunit (PRKAG1), transcript variant 4 |
USD 420.00 |
|
RG232409 | PRKAG1 (GFP-tagged) - Homo sapiens protein kinase, AMP-activated, gamma 1 non-catalytic subunit (PRKAG1), transcript variant 4 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review