HSD11B1 (NM_001206741) Human Untagged Clone

CAT#: SC329835

HSD11B1 (untagged) - Homo sapiens hydroxysteroid (11-beta) dehydrogenase 1 (HSD11B1), transcript variant 3


  "NM_001206741" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HSD11B1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HSD11B1
Synonyms 11-beta-HSD1; 11-DH; CORTRD2; HDL; HSD11; HSD11B; HSD11L; SDR26C1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001206741, the custom clone sequence may differ by one or more nucleotides


ATGGCTTTTATGAAAAAATATCTCCTCCCCATTCTGGGGCTCTTCATGGCCTACTACTACTATTCTGCAA
ACGAGGAATTCAGACCAGAGATGCTCCAAGGAAAGAAAGTGATTGTCACAGGGGCCAGCAAAGGGATCGG
AAGAGAGATGGCTTATCATCTGGCGAAGATGGGAGCCCATGTGGTGGTGACAGCGAGGTCAAAAGAAACT
CTACAGAAGGTGGTATCCCACTGCCTGGAGCTTGGAGCAGCCTCAGCACACTACATTGCTGGCACCATGG
AAGACATGACCTTCGCAGAGCAATTTGTTGCCCAAGCAGGAAAGCTCATGGGAGGACTAGACATGCTCAT
TCTCAACCACATCACCAACACTTCTTTGAATCTTTTTCATGATGATATTCACCATGTGCGCAAAAGCATG
GAAGTCAACTTCCTCAGTTACGTGGTCCTGACTGTAGCTGCCTTGCCCATGCTGAAGCAGAGCAATGGAA
GCATTGTTGTCGTCTCCTCTCTGGCTGGGAAAGTGGCTTATCCAATGGTTGCTGCCTATTCTGCAAGCAA
GTTTGCTTTGGATGGGTTCTTCTCCTCCATCAGAAAGGAATATTCAGTGTCCAGGGTCAATGTATCAATC
ACTCTCTGTGTTCTTGGCCTCATAGACACAGAAACAGCCATGAAGGCAGTTTCTGGGATAGTCCATATGC
AAGCAGCTCCAAAGGAGGAATGTGCCCTGGAGATCATCAAAGGGGGAGCTCTGCGCCAAGAAGAAGTGTA
TTATGACAGCTCACTCTGGACCACTCTTCTGATCAGAAATCCATGCAGGAAGATCCTGGAATTTCTCTAC
TCAACGAGCTATAATATGGACAGATTCATAAACAAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001206741
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001206741.1, NP_001193670.1
RefSeq Size 1479 bp
RefSeq ORF 879 bp
Locus ID 3290
Cytogenetics 1q32.2
Protein Families Druggable Genome, Transmembrane
Protein Pathways Androgen and estrogen metabolism, C21-Steroid hormone metabolism, Metabolic pathways
Gene Summary 'The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2011]'
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.