HSD11B1 (NM_001206741) Human Untagged Clone

CAT#: SC329835

HSD11B1 (untagged) - Homo sapiens hydroxysteroid (11-beta) dehydrogenase 1 (HSD11B1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HSD11B1
• Synonyms: 11-beta-HSD1; 11-DH; CORTRD2; HDL; HSD11; HSD11B; HSD11L; SDR26C1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001206741, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTTTTATGAAAAAATATCTCCTCCCCATTCTGGGGCTCTTCATGGCCTACTACTACTATTCTGCAA
  ACGAGGAATTCAGACCAGAGATGCTCCAAGGAAAGAAAGTGATTGTCACAGGGGCCAGCAAAGGGATCGG
  AAGAGAGATGGCTTATCATCTGGCGAAGATGGGAGCCCATGTGGTGGTGACAGCGAGGTCAAAAGAAACT
  CTACAGAAGGTGGTATCCCACTGCCTGGAGCTTGGAGCAGCCTCAGCACACTACATTGCTGGCACCATGG
  AAGACATGACCTTCGCAGAGCAATTTGTTGCCCAAGCAGGAAAGCTCATGGGAGGACTAGACATGCTCAT
  TCTCAACCACATCACCAACACTTCTTTGAATCTTTTTCATGATGATATTCACCATGTGCGCAAAAGCATG
  GAAGTCAACTTCCTCAGTTACGTGGTCCTGACTGTAGCTGCCTTGCCCATGCTGAAGCAGAGCAATGGAA
  GCATTGTTGTCGTCTCCTCTCTGGCTGGGAAAGTGGCTTATCCAATGGTTGCTGCCTATTCTGCAAGCAA
  GTTTGCTTTGGATGGGTTCTTCTCCTCCATCAGAAAGGAATATTCAGTGTCCAGGGTCAATGTATCAATC
  ACTCTCTGTGTTCTTGGCCTCATAGACACAGAAACAGCCATGAAGGCAGTTTCTGGGATAGTCCATATGC
  AAGCAGCTCCAAAGGAGGAATGTGCCCTGGAGATCATCAAAGGGGGAGCTCTGCGCCAAGAAGAAGTGTA
  TTATGACAGCTCACTCTGGACCACTCTTCTGATCAGAAATCCATGCAGGAAGATCCTGGAATTTCTCTAC
  TCAACGAGCTATAATATGGACAGATTCATAAACAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206741
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001206741.1, NP_001193670.1
• RefSeq Size: 1479 bp
• RefSeq ORF: 879 bp
• Locus ID: 3290
• Cytogenetics: 1q32.2
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Androgen and estrogen metabolism, C21-Steroid hormone metabolism, Metabolic pathways
• Gene Summary: 'The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2011]'
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.