RAB11A (NM_001206836) Human Untagged Clone

CAT#: SC329841

RAB11A (untagged) - Homo sapiens RAB11A, member RAS oncogene family (RAB11A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAB11A
• Synonyms: YL8
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001206836, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCACCCGCGACGACGAGTACGACTACCTCTTTAAAGTTGTCCTTATTGGAGATTCTGGTGTTGGAA
  AGAGTAATCTCCTGTCTCGATTTACTCGAAATGAGTTTAATCTGGAAAGCAAGAGCACCATTGGAGTAGA
  GTTTGCAACAAGAAGCATCCAGGTTGATGGAAAAACAATAAAGGCACAGATATGGGACACAGCAGGGCAA
  GAGCGATATCGAGCTATAACATCAGCATATTATCGTGGAGCTGTAGGTGCCTTATTGGTTTATGACATTG
  CTAAACATCTCACATATGAAAATGTAGAGCGATGGCTGAAAGAACTGAGAGATCATGCTGATAGTAACAT
  TGTTATCATGCTTGTGGGCAATAAGAGTGATCTACGTCATCTCAGGGCAGTTCCTACAGATGAAGCAAGA
  GCTTTTGCAGAAAAGAATGAAGCAAATGTCAGACAGACGCGAAAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206836
• ORF Size: 468 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001206836.1, NP_001193765.1
• RefSeq Size: 4848
• RefSeq ORF: 468
• Locus ID: 8766
• Protein Families: Druggable Genome
• Protein Pathways: Endocytosis
• Gene Summary: The protein encoded by this gene belongs to the Rab family of the small GTPase superfamily. It is associated with both constitutive and regulated secretory pathways, and may be involved in protein transport. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
  Transcript Variant: This variant (2) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.