RAB11A (NM_001206836) Human Untagged Clone
CAT#: SC329841
RAB11A (untagged) - Homo sapiens RAB11A, member RAS oncogene family (RAB11A), transcript variant 2
"NM_001206836" in other vectors (2)
Product Images
Other products for "RAB11A"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RAB11A |
Synonyms | YL8 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001206836, the custom clone sequence may differ by one or more nucleotides
ATGGGCACCCGCGACGACGAGTACGACTACCTCTTTAAAGTTGTCCTTATTGGAGATTCTGGTGTTGGAA AGAGTAATCTCCTGTCTCGATTTACTCGAAATGAGTTTAATCTGGAAAGCAAGAGCACCATTGGAGTAGA GTTTGCAACAAGAAGCATCCAGGTTGATGGAAAAACAATAAAGGCACAGATATGGGACACAGCAGGGCAA GAGCGATATCGAGCTATAACATCAGCATATTATCGTGGAGCTGTAGGTGCCTTATTGGTTTATGACATTG CTAAACATCTCACATATGAAAATGTAGAGCGATGGCTGAAAGAACTGAGAGATCATGCTGATAGTAACAT TGTTATCATGCTTGTGGGCAATAAGAGTGATCTACGTCATCTCAGGGCAGTTCCTACAGATGAAGCAAGA GCTTTTGCAGAAAAGAATGAAGCAAATGTCAGACAGACGCGAAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206836 |
ORF Size | 468 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001206836.1, NP_001193765.1 |
RefSeq Size | 4848 |
RefSeq ORF | 468 |
Locus ID | 8766 |
Protein Families | Druggable Genome |
Protein Pathways | Endocytosis |
Gene Summary | The protein encoded by this gene belongs to the Rab family of the small GTPase superfamily. It is associated with both constitutive and regulated secretory pathways, and may be involved in protein transport. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011] Transcript Variant: This variant (2) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.