GSG1 (NM_001206843) Human Untagged Clone

CAT#: SC329843

GSG1 (untagged) - Homo sapiens germ cell associated 1 (GSG1), transcript variant 6


  "NM_001206843" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GSG1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GSG1
Synonyms MGC3146; MGC111023
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001206843, the custom clone sequence may differ by one or more nucleotides


ATGGCCAAGATGGAGCTCTCGAAGGCCTTCTCTGGCCAGCGGACACTCCTATCTGCCATCCTCAGCATGC
TATCACTCAGCTTCTCCACAACATCCCTGCTCAGCAACTACTGGTTTGTGGGCACACAGAAGGTGCCCAA
GCCCCTGTGCGAGAAAGGTCTGGCAGCCAAGTGCTTTGACATGCCAGTGTCCCTGGATGGAGATACCAAC
ACATCCACCCAGGAGGTGGTACAATACAACTGGGAGACTGGGGATGACCGGTTCTCCTTCCGGAGCTTCC
GGAGTGGCATGTGGCTATCCTGTGAGGAAACTGTGGAAGAACCAGCACTGCTCCATCCCCAGTCCTGGAA
ACAATTTAGAGCCCTTCGGTCCAGTGGTACAGCGGCAGCAAAAGGGGAGAGGTGCCGAAGTTTCATTGAA
CTTACACCACCAGCCAAGAGAGGTCTCCTGGGGATGGTGGCCCACATGATGTATTCACAAGTCTTCCAAG
CGACTGTCAACTTGGGTCCAGAAGACTGGAGACCACATGTTTGGAATTATGGCTGGGCCTTCTACATGGC
CTGGCTCTCCTTCACCTGCTGCATGGCGTCGGCTGTCACCACCTTCAACACGTACACCAGGATGGTGCTG
GAGTTCAAGTGCAAGCATAGTAAGAGCTTCAAGGAAAACCCGAACTGCCTACCACATCACCATCAGTGTT
TCCCTCGGCGGCTGTCAAGTGCAGCCCCCACCGTGGGTCCTTTGACCAGCTACCACCAGTATCATAATCA
GCCCATCCACTCTGTCTCTGAGGGAGTCGACTTCTACTCCGAGCTGCGGAACAAGGGATTTCAAAGAGGG
GCCAGCCAGGAGCTGAAAGAAGCAGTTAGGTCATCTGTAGAGGAAGAGCAGTGTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001206843
ORF Size 897 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001206843.1, NP_001193772.1
RefSeq Size 2460
RefSeq ORF 897
Locus ID 83445
Protein Families Transmembrane
Gene Summary May cause the redistribution of PAPOLB from the cytosol to the endoplasmic reticulum. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) includes an alternate in-frame exon in the central coding region and uses an alternate splice site that causes a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (6) has a distinct C-terminus and is longer than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.