CTDSP1 (NM_001206878) Human Untagged Clone

CAT#: SC329848

CTDSP1 (untagged) - Homo sapiens CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), transcript variant 3


  "NM_001206878" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CTDSP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CTDSP1
Synonyms NIF3; NLI-IF; NLIIF; SCP1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001206878, the custom clone sequence may differ by one or more nucleotides


ATGGTGGCCGCCCCGTGGGCTACCCAGGAGCAGGAGGAGGGCCGAGGGATCCAGCCCGGGGACCGGGGTG
ACCAGAAGTCAGCAGCTTCCCAGAAGCCCCGAAGCCGGGGCATCCTCCACTCACTCTTCTGCTGTGTCTG
CCGGGATGATGGGGAGGCCCTGCCTGCTCACAGCGGGGCGCCCCTGCTTGTGGAGGAGAATGGCGCCATC
CCTAAGACCCCAGTCCAATACCTGCTCCCTGAGGCCAAGGCCCAGGACTCAGACAAGATCTGCGTGGTCA
TCGACCTGGACGAGACCCTGGTGCACAGCTCCTTCAAGCCAGTGAACAACGCGGACTTCATCATCCCTGT
GGAGATTGATGGGGTGGTCCACCAGGTCTACGTGTTGAAGCGTCCTCACGTGGATGAGTTCCTGCAGCGA
ATGGGCGAGCTCTTTGAATGTGTGCTGTTCACTGCTAGCCTCGCCAAGTACGCAGACCCAGTAGCTGACC
TGCTGGACAAATGGGGGGCCTTCCGGGCCCGGCTGTTTCGAGAGTCCTGCGTCTTCCACCGGGGGAACTA
CGTGAAGGACCTGAGCCGGTTGGGTCGAGACCTGCGGCGGGTGCTCATCCTGGACAATTCACCTGCCTCC
TATGTCTTCCATCCAGACAATGCTGTACCGGTGGCCTCGTGGTTTGACAACATGAGTGACACAGAGCTCC
ACGACCTCCTCCCCTTCTTCGAGCAACTCAGCCGTGTGGACGACGTGTACTCAGTGCTCAGGCAGCCACG
GCCAGGGAGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001206878
ORF Size 783 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001206878.1, NP_001193807.1
RefSeq Size 2391
RefSeq ORF 783
Locus ID 58190
Protein Families Phosphatase
Gene Summary This gene encodes a member of the small C-terminal domain phosphatase (SCP) family of nuclear phosphatases. These proteins play a role in transcriptional regulation through specific dephosphorylation of phosphoserine 5 within tandem heptapeptide repeats of the C-terminal domain of RNA polymerase II. The encoded protein plays a role in neuronal gene silencing in non-neuronal cells, and may also inhibit osteoblast differentiation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (3) differs in the 5' UTR and has multiple differences in the coding region, including the use of an alternate start codon, compared to variant 1. The encoded isoform (3) is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.