CTDSP1 (NM_001206878) Human Untagged Clone
CAT#: SC329848
CTDSP1 (untagged) - Homo sapiens CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), transcript variant 3
"NM_001206878" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CTDSP1 |
Synonyms | NIF3; NLI-IF; NLIIF; SCP1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001206878, the custom clone sequence may differ by one or more nucleotides
ATGGTGGCCGCCCCGTGGGCTACCCAGGAGCAGGAGGAGGGCCGAGGGATCCAGCCCGGGGACCGGGGTG ACCAGAAGTCAGCAGCTTCCCAGAAGCCCCGAAGCCGGGGCATCCTCCACTCACTCTTCTGCTGTGTCTG CCGGGATGATGGGGAGGCCCTGCCTGCTCACAGCGGGGCGCCCCTGCTTGTGGAGGAGAATGGCGCCATC CCTAAGACCCCAGTCCAATACCTGCTCCCTGAGGCCAAGGCCCAGGACTCAGACAAGATCTGCGTGGTCA TCGACCTGGACGAGACCCTGGTGCACAGCTCCTTCAAGCCAGTGAACAACGCGGACTTCATCATCCCTGT GGAGATTGATGGGGTGGTCCACCAGGTCTACGTGTTGAAGCGTCCTCACGTGGATGAGTTCCTGCAGCGA ATGGGCGAGCTCTTTGAATGTGTGCTGTTCACTGCTAGCCTCGCCAAGTACGCAGACCCAGTAGCTGACC TGCTGGACAAATGGGGGGCCTTCCGGGCCCGGCTGTTTCGAGAGTCCTGCGTCTTCCACCGGGGGAACTA CGTGAAGGACCTGAGCCGGTTGGGTCGAGACCTGCGGCGGGTGCTCATCCTGGACAATTCACCTGCCTCC TATGTCTTCCATCCAGACAATGCTGTACCGGTGGCCTCGTGGTTTGACAACATGAGTGACACAGAGCTCC ACGACCTCCTCCCCTTCTTCGAGCAACTCAGCCGTGTGGACGACGTGTACTCAGTGCTCAGGCAGCCACG GCCAGGGAGCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206878 |
ORF Size | 783 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001206878.1, NP_001193807.1 |
RefSeq Size | 2391 |
RefSeq ORF | 783 |
Locus ID | 58190 |
Protein Families | Phosphatase |
Gene Summary | This gene encodes a member of the small C-terminal domain phosphatase (SCP) family of nuclear phosphatases. These proteins play a role in transcriptional regulation through specific dephosphorylation of phosphoserine 5 within tandem heptapeptide repeats of the C-terminal domain of RNA polymerase II. The encoded protein plays a role in neuronal gene silencing in non-neuronal cells, and may also inhibit osteoblast differentiation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (3) differs in the 5' UTR and has multiple differences in the coding region, including the use of an alternate start codon, compared to variant 1. The encoded isoform (3) is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232311 | CTDSP1 (Myc-DDK tagged) - Homo sapiens CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), transcript variant 3 |
USD 420.00 |
|
RG232311 | CTDSP1 (GFP-tagged) - Homo sapiens CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), transcript variant 3 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review