RAGE (AGER) (NM_001206954) Human Untagged Clone

CAT#: SC329863

AGER (untagged) - Homo sapiens advanced glycosylation end product-specific receptor (AGER), transcript variant 8


  "NM_001206954" in other vectors (2)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "AGER"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AGER
Synonyms RAGE; SCARJ1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001206954, the custom clone sequence may differ by one or more nucleotides


ATGGCAGCCGGAACAGCAGTTGGAGCCTGGGTGCTGGTCCTCAGTCTGTGGGGGGCAGTAGTAGGTGCTC
AAAACATCACAGCCCGGATTGGCGAGCCACTGGTGCTGAAGTGTAAGGGGGCCCCCAAGAAACCACCCCA
GCGGCTGGAATGGAAACTGAACACAGGCCGGACAGAAGCTTGGAAGGTCCTGTCTCCCCAGGGAGGAGGC
CCCTGGGACAGTGTGGCTCGTGTCCTTCCCAACGGCTCCCTCTTCCTTCCGGCTGTCGGGATCCAGGATG
AGGGGATTTTCCGGTGCCAGGCAATGAACAGGAATGGAAAGGAGACCAAGTCCAACTACCGAGTCCGTGT
CTACCAGATTCCTGGGAAGCCAGAAATTGTAGATTCTGCCTCTGAACTCACGGCTGGTGTTCCCAATAAG
GTGGGGACATGTGTGTCAGAGGGAAGCTACCCTGCAGGGACTCTTAGCTGGCACTTGGATGGGAAGCCCC
TGGTGCCTAATGAGAAGGGAGTATCTGTGAAGGAACAGACCAGGAGACACCCTGAGACAGGGCTCTTCAC
ACTGCAGTCGGAGCTAATGGTGACCCCAGCCCGGGGAGGAGATCCCCGTCCCACCTTCTCCTGTAGCTTC
AGCCCAGGCCTTCCCCGACACCGGGCCTTGCGCACAGCCCCCATCCAGCCCCGTGTCTGGGAGCCTGTGC
CTCTGGAGGAGGTCCAATTGGTGGTGGAGCCAGAAGGTGGAGCAGTAGCTCCTGGTGGAACCGTAACCCT
GACCTGTGAAGTCCCTGCCCAGCCCTCTCCTCAAATCCACTGGATGAAGGATAACCAGGCGAGGAGGGGC
CAACTGCAGGTGAGGGGTTTGATAAAGTCAGGGAAGCAGAAGATAGCCCCCAACACATGTGACTGGGGGG
ATGGTCAACAAGAAAGGAATGGAAGGCCCCAGAAAACCAGGAGGAAGAGGAGGAGCGTGCAGAACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001206954
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001206954.1, NP_001193883.1
RefSeq Size 1321 bp
RefSeq ORF 978 bp
Locus ID 177
Cytogenetics 6p21.32
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Gene Summary 'The advanced glycosylation end product (AGE) receptor encoded by this gene is a member of the immunoglobulin superfamily of cell surface receptors. It is a multiligand receptor, and besides AGE, interacts with other molecules implicated in homeostasis, development, and inflammation, and certain diseases, such as diabetes and Alzheimer's disease. Many alternatively spliced transcript variants encoding different isoforms, as well as non-protein-coding variants, have been described for this gene (PMID:18089847). [provided by RefSeq, May 2011]'
Transcript Variant: This variant (8, also known as RAGE_v8) lacks two internal coding exons, and uses an alternate donor splice site at another coding exon compared to variant 1. This results in a frame-shift, and a shorter isoform (8) with a distinct C-terminus compared to isoform 1. Sequence Note: This Refseq, containing two in-frame translation initiation codons (at nt 8-10 and nt 101-103), is annotated with a CDS starting from the downstream AUG (dAUG) because the AGE receptor encoded by this gene is a known type 1 transmembrane protein requiring signal peptide for its function, and a signal peptide of 22 aa is predicted for the dAUG initiated protein. Translation initiation from the upstream AUG (uAUG) will add an extra 31 aa to the N-terminus, and no signal peptide is predicted for the uAUG initiated protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.