IL21 (NM_001207006) Human Untagged Clone

CAT#: SC329883

IL21 (untagged) - Homo sapiens interleukin 21 (IL21), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL21
• Synonyms: CVID11; IL-21; Za11
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001207006, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGATCCAGTCCTGGCAACATGGAGAGGATTGTCATCTGTCTGATGGTCATCTTCTTGGGGACACTGG
  TCCACAAATCAAGCTCCCAAGGTCAAGATCGCCACATGATTAGAATGCGTCAACTTATAGATATTGTTGA
  TCAGCTGAAAAATTATGTGAATGACTTGGTCCCTGAATTTCTGCCAGCTCCAGAAGATGTAGAGACAAAC
  TGTGAGTGGTCAGCTTTTTCCTGCTTTCAGAAGGCCCAACTAAAGTCAGCAAATACAGGAAACAATGAAA
  GGATAATCAATGTATCAATTAAAAAGCTGAAGAGGAAACCACCTTCCACAAATGCAGGGAGAAGACAGAA
  ACACAGACTAACATGCCCTTCATGTGATTCTTATGAGAAAAAACCACCCAAAGAATTCCTAGAAAGATTC
  AAATCACTTCTCCAAAAGGTATCTACCTTAAGTTTCATTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001207006
• ORF Size: 462 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001207006.2, NP_001193935.1
• RefSeq Size: 707
• RefSeq ORF: 462
• Locus ID: 59067
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
• Gene Summary: This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (2) retains an intron compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.