Kallikrein 7 (KLK7) (NM_001207053) Human Untagged Clone

CAT#: SC329897

KLK7 (untagged) - Homo sapiens kallikrein-related peptidase 7 (KLK7), transcript variant 3


  "NM_001207053" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KLK7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KLK7
Synonyms hK7; PRSS6; SCCE
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001207053, the custom clone sequence may differ by one or more nucleotides


ATGAATGAGTACACCGTGCACCTGGGCAGTGATACGCTGGGCGACAGGAGAGCTCAGAGGATCAAGGCCT
CGAAGTCATTCCGCCACCCCGGCTACTCCACACAGACCCATGTTAATGACCTCATGCTCGTGAAGCTCAA
TAGCCAGGCCAGGCTGTCATCCATGGTGAAGAAAGTCAGGCTGCCCTCCCGCTGCGAACCCCCTGGAACC
ACCTGTACTGTCTCCGGCTGGGGCACTACCACGAGCCCAGATGTGACCTTTCCCTCTGACCTCATGTGCG
TGGATGTCAAGCTCATCTCCCCCCAGGACTGCACGAAGGTTTACAAGGACTTACTGGAAAATTCCATGCT
GTGCGCTGGCATCCCCGACTCCAAGAAAAACGCCTGCAATGGTGACTCAGGGGGACCGTTGGTGTGCAGA
GGTACCCTGCAAGGTCTGGTGTCCTGGGGAACTTTCCCTTGCGGCCAACCCAATGACCCAGGAGTCTACA
CTCAAGTGTGCAAGTTCACCAAGTGGATAAATGACACCATGAAAAAGCATCGCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001207053
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001207053.1, NP_001193982.1
RefSeq Size 1973 bp
RefSeq ORF 546 bp
Locus ID 5650
Cytogenetics 19q13.41
Protein Families Druggable Genome, Secreted Protein
Gene Summary 'This gene encodes a member of the kallikrein subfamily of serine proteases. These enzymes have diverse physiological functions and many kallikrein genes are biomarkers for cancer. The encoded protein has chymotrypsin-like activity and plays a role in the proteolysis of intercellular cohesive structures that precedes desquamation, the shedding of the outermost layer of the epidermis. The encoded protein may play a role in cancer invasion and metastasis, and increased expression of this gene is associated with unfavorable prognosis and progression of several types of cancer. Polymorphisms in this gene may play a role in the development of atopic dermatitis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, which is one of fifteen kallikrein subfamily members located in a gene cluster on chromosome 19. [provided by RefSeq, May 2011]'
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream, in-frame start site, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript sequence data to make the sequence consistent with the reference genome assembly, which represents the 'AACCAACC' allele with regards to the 3' UTR polymorphism described in PMID 15191543.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.