CXADR (NM_001207063) Human Untagged Clone

CAT#: SC329901

CXADR (untagged) - Homo sapiens coxsackie virus and adenovirus receptor (CXADR), transcript variant 2


  "NM_001207063" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CXADR"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CXADR
Synonyms CAR; CAR4/6; HCAR
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001207063, the custom clone sequence may differ by one or more nucleotides


ATGGCGCTCCTGCTGTGCTTCGTGCTCCTGTGCGGAGTAGTGGATTTCGCCAGAAGTTTGAGTATCACTA
CTCCTGAAGAGATGATTGAAAAAGCCAAAGGGGAAACTGCCTATCTGCCATGCAAATTTACGCTTAGTCC
CGAAGACCAGGGACCGCTGGACATCGAGTGGCTGATATCACCAGCTGATAATCAGAAGGTGGATCAAGTG
ATTATTTTATATTCTGGAGACAAAATTTATGATGACTACTATCCAGATCTGAAAGGCCGAGTACATTTTA
CGAGTAATGATCTCAAATCTGGTGATGCATCAATAAATGTAACGAATTTACAACTGTCAGATATTGGCAC
ATATCAGTGCAAAGTGAAAAAAGCTCCTGGTGTTGCAAATAAGAAGATTCATCTGGTAGTTCTTGTTAAG
CCTTCAGGTGCGAGATGTTACGTTGATGGATCTGAAGAAATTGGAAGTGACTTTAAGATAAAATGTGAAC
CAAAAGAAGGTTCACTTCCATTACAGTATGAGTGGCAAAAATTGTCTGACTCACAGAAAATGCCCACTTC
ATGGTTAGCAGGGAAGATGTGCCACCTCCAAAGAGCCGTACGTCCACTGCCAGAAGCTACATCGGCAGTA
ATCATTCATCCCTGGGGTCCATGTCTCCTTCCAACATGGAAGGATATTCCAAGACTCAGTATAACCAAGT
ACCAAGTGAAGACTTTGAACGCACTCCTCAGAGTCCGACTCTCCCACCTGCTAAGGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001207063
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001207063.1, NP_001193992.1
RefSeq Size 5482 bp
RefSeq ORF 759 bp
Locus ID 1525
Cytogenetics 21q21.1
Protein Families Druggable Genome, Stem cell - Pluripotency, Transmembrane
Protein Pathways Viral myocarditis
Gene Summary 'The protein encoded by this gene is a type I membrane receptor for group B coxsackieviruses and subgroup C adenoviruses. Several transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene are found on chromosomes 15, 18, and 21. [provided by RefSeq, May 2011]'
Transcript Variant: This variant (2, alternatively referred to as beta or CAR4/7) lacks two consecutive alternate coding exons compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.