CXADR (NM_001207066) Human Untagged Clone
CAT#: SC329904
CXADR (untagged) - Homo sapiens coxsackie virus and adenovirus receptor (CXADR), transcript variant 5
"NM_001207066" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "CXADR"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CXADR |
Synonyms | CAR; CAR4/6; HCAR |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001207066, the custom clone sequence may differ by one or more nucleotides
ATGGCGCTCCTGCTGTGCTTCGTGCTCCTGTGCGGAGTAGTGGATTTCGCCAGAAGTTTGAGTATCACTA CTCCTGAAGAGATGATTGAAAAAGCCAAAGGGGAAACTGCCTATCTGCCATGCAAATTTACGCTTAGTCC CGAAGACCAGGGACCGCTGGACATCGAGTGGCTGATATCACCAGCTGATAATCAGAAGGTGGATCAAGTG ATTATTTTATATTCTGGAGACAAAATTTATGATGACTACTATCCAGATCTGAAAGGCCGAGTACATTTTA CGAGTAATGATCTCAAATCTGGTGATGCATCAATAAATGTAACGAATTTACAACTGTCAGATATTGGCAC ATATCAGTGCAAAGTGAAAAAAGCTCCTGGTGTTGCAAATAAGAAGATTCATCTGGTAGTTCTTGTTAAG CCTTCAGGTGCGAGATGTTACGTTGATGGATCTGAAGAAATTGGAAGTGACTTTAAGATAAAATGTGAAC CAAAAGAAGGTTCACTTCCATTACAGTATGAGTGGCAAAAATTGTCTGACTCACAGAAAATGCCCACTTC ATGGTTAGCAGAAATGACTTCATCTGTTATATCTGTAAAAAATGCCTCTTCTGAGTACTCTGGGACATAC AGCTGTACAGTCAGAAACAGAGTGGGCTCTGATCAGTGCCTGTTGCGTCTAAACGTTGTCCCTCCTTCAA ATAAAGCTGGACTAATTGCAGGAGCCATTATAGGAACTTTGCTTGCTCTAGCGCTCATTGGTCTTATCAT CTTTTGCTGTCGTAAAAAGCGCAGAGAAGAAAAATATGAAAAGGAAGTTCATCACGATATCAGGGAAGAT GTGCCACCTCCAAAGAGCCGTACGTCCACTGCCAGAAGCTACATCGGCAGTAATCATTCATCCCTGGGGT CCATGTCTCCTTCCAACATGGAAGGATATTCCAAGACTCAGTATAACCAAGTACCAAGTGAAGACTTTGA ACGCACTCCTCAGAGTCCGACTCTCCCACCTGCTAAGTTCAAGTACCCTTACAAGACTGATGGAATTACA GTTGTATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001207066 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001207066.1, NP_001193995.1 |
RefSeq Size | 1669 bp |
RefSeq ORF | 1059 bp |
Locus ID | 1525 |
Cytogenetics | 21q21.1 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transmembrane |
Protein Pathways | Viral myocarditis |
Gene Summary | 'The protein encoded by this gene is a type I membrane receptor for group B coxsackieviruses and subgroup C adenoviruses. Several transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene are found on chromosomes 15, 18, and 21. [provided by RefSeq, May 2011]' Transcript Variant: This variant (5, alternatively referred to as CAREx8) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (5) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.