CDHH (CDH13) (NM_001220491) Human Untagged Clone

CAT#: SC329911

CDH13 (untagged) - Homo sapiens cadherin 13 (CDH13), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CDH13
• Synonyms: CDHH; P105
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001220491, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGCCGAGAACTCCGCTCGTTCTGTGCGTTCTCCTGTCCCAGGTGCTGCTGCTAACATCTGCAGAAG
  ATTTGGACTGCACTCCTGGATTTCAGCAGAAAGTGTTCCATATCAATCAGCCAGCTGAATTCATTGAGGA
  CCAGTCAATTCTAAACTTGACCTTCAGTGACTGTAAGGGAAACGACAAGCTACGCTATGAGGTCTCGAGC
  CCATACTTCAAGGTGAACAGCGATGGCGGCTTAGTTGCTCTGAGAAACATAACTGCAGTGGGCAAAACTC
  TGTTCGTCCATGCACGGACCCCCCATGCGGAAGATATGGCAGAACTCGTGATTGTCGGGGGGAAAGACAT
  CCAGGGCTCCTTGCAGGATATATTTAAATTTGCAAGAACTTCTCCTGTCCCAAGACAAAAGAGGTCCATT
  GTGGTATCTCCCATTTTAATTCCAGAGAATCAGAGACAGCCTTTCCCAAGAGATGTTGGCAAGAGAACCC
  ACAATCCTATTAACAGCGAACTTCTCTTGAATGAAGGCATTACAGCAGATTTAAATCCATGCATTACAAT
  TTTAGCAATTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001220491
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001220491.1, NP_001207420.1
• RefSeq Size: 955 bp
• RefSeq ORF: 573 bp
• Locus ID: 1012
• Cytogenetics: 16q23.3
• Gene Summary: 'This gene encodes a member of the cadherin superfamily. The encoded protein is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. The protein lacks the cytoplasmic domain characteristic of other cadherins, and so is not thought to be a cell-cell adhesion glycoprotein. This protein acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. The gene is hypermethylated in many types of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2011]'
  Transcript Variant: This variant (5) lacks several coding exons and uses an alternate 3' terminal exon, compared to variant 1. It encodes isoform 5, which is shorter and has a distinct C-terminus, compared to isoform 1.