ANAPC13 (NM_001242375) Human Untagged Clone

CAT#: SC329942

ANAPC13 (untagged) - Homo sapiens anaphase promoting complex subunit 13 (ANAPC13), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ANAPC13
• Synonyms: APC13; SWM1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001242375, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACAGTGAGGTTCAGAGAGATGGAAGGATCTTGGATTTGATTGATGATGCTTGGCGAGAAGACAAGC
  TGCCTTATGAGGATGTCGCAATACCACTGAATGAGCTTCCTGAACCTGAACAAGACAATGGTGGCACCAC
  AGAATCTGTCAAAGAACAAGAAATGAAGTGGACAGACTTAGCCTTACAGTACCTCCATGAGAATGTTCCC
  CCCATTGGAAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242375
• ORF Size: 225 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001242375.1, NP_001229304.1
• RefSeq Size: 1444
• RefSeq ORF: 225
• Locus ID: 25847
• Protein Pathways: Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis
• Gene Summary: This gene encodes a component of the anaphase promoting complex, a large ubiquitin-protein ligase that controls cell cycle progression by regulating the degradation of cell cycle regulators such as B-type cyclins. The encoded protein is evolutionarily conserved and is required for the integrity and ubiquitin ligase activity of the anaphase promoting complex. Pseudogenes and splice variants have been found for this gene; however, the biological validity of some of the splice variants has not been determined. [provided by RefSeq, Nov 2008]
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 2. Variants 1, 2 and 3 encode the same protein.