ANAPC13 (NM_001242375) Human Untagged Clone
CAT#: SC329942
ANAPC13 (untagged) - Homo sapiens anaphase promoting complex subunit 13 (ANAPC13), transcript variant 3
"NM_001242375" in other vectors (2)
Product Images
Other products for "ANAPC13"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | ANAPC13 |
| Synonyms | APC13; SWM1 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001242375, the custom clone sequence may differ by one or more nucleotides
ATGGACAGTGAGGTTCAGAGAGATGGAAGGATCTTGGATTTGATTGATGATGCTTGGCGAGAAGACAAGC TGCCTTATGAGGATGTCGCAATACCACTGAATGAGCTTCCTGAACCTGAACAAGACAATGGTGGCACCAC AGAATCTGTCAAAGAACAAGAAATGAAGTGGACAGACTTAGCCTTACAGTACCTCCATGAGAATGTTCCC CCCATTGGAAACTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001242375 |
| ORF Size | 225 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | NM_001242375.1, NP_001229304.1 |
| RefSeq Size | 1444 |
| RefSeq ORF | 225 |
| Locus ID | 25847 |
| Protein Pathways | Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis |
| Gene Summary | This gene encodes a component of the anaphase promoting complex, a large ubiquitin-protein ligase that controls cell cycle progression by regulating the degradation of cell cycle regulators such as B-type cyclins. The encoded protein is evolutionarily conserved and is required for the integrity and ubiquitin ligase activity of the anaphase promoting complex. Pseudogenes and splice variants have been found for this gene; however, the biological validity of some of the splice variants has not been determined. [provided by RefSeq, Nov 2008] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 2. Variants 1, 2 and 3 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China