TREM1 (NM_001242589) Human Untagged Clone

CAT#: SC329988

TREM1 (untagged) - Homo sapiens triggering receptor expressed on myeloid cells 1 (TREM1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TREM1
• Synonyms: CD354; TREM-1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001242589, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGGAAGACCAGGCTCTGGGGGCTGCTGTGGATGCTCTTTGTCTCAGAACTCCGAGCTGCAACTAAAT
  TAACTGAGGAAAAGTATGAACTGAAAGAGGGGCAGACCCTGGATGTGAAATGTGACTACACGCTAGAGAA
  GTTTGCCAGCAGCCAGAAAGCTTGGCAGATAATAAGGGACGGAGAGATGCCCAAGACCCTGGCATGCACA
  GAGAGGCCTTCAAAGAATTCCCATCCAGTCCAAGTGGGGAGGATCATACTAGAAGACTACCATGATCATG
  GTTTACTGCGCGTCCGAATGGTCAACCTTCAAGTGGAAGATTCTGGACTGTATCAGTGTGTGATCTACCA
  GCCTCCCAAGGAGCCTCACATGCTGTTCGATCGCATCCGCTTGGTGGTGACCAAGGGTTTTTCAGGGACC
  CCTGGCTCCAATGAGAATTCTACCCAGAATGTGTATAAGATTCCTCCTACCACCACTAAGGCCTTGTGCC
  CACTCTATACCAGCCCCAGAACTGTGACCCAAGCTCCACCCAAGTCAACTGCCGATGTCTCCACTCCTGA
  CTCTGAAATCAACCTTACAAATGTGACAGATATCATCAGGTATAGTTTCCAGGTCCCTGGGCCCCTGGTT
  TGGACACTGAGCCCTTTGTTTCCCAGTCTGTGTGCTGAGAGGATGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242589
• ORF Size: 678 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001242589.1, NP_001229518.1
• RefSeq Size: 2102
• RefSeq ORF: 678
• Locus ID: 54210
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Gene Summary: This gene encodes a receptor belonging to the Ig superfamily that is expressed on myeloid cells. This protein amplifies neutrophil and monocyte-mediated inflammatory responses triggered by bacterial and fungal infections by stimulating release of pro-inflammatory chemokines and cytokines, as well as increased surface expression of cell activation markers. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jun 2011]
  Transcript Variant: This variant (2) differs at the 3' end compared to variant 1. This results in a shorter isoform (2) with a distinct C-terminus, lacking the transmembrane domain, compared to isoform 1.