PKC zeta (PRKCZ) (NM_001242874) Human Untagged Clone

CAT#: SC330041

PRKCZ (untagged) - Homo sapiens protein kinase C, zeta (PRKCZ), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRKCZ
• Synonyms: PKC-ZETA; PKC2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001242874, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTCACCCCGAGGACGGATGAATCTATCTACCGCCGGGGAGCCAGAAGATGGAGGAAGCTGTACCGTG
  CCAACGGCCACCTCTTCCAAGCCAAGCGCTTTAACAGGAGAGCGTACTGCGGTCAGTGCAGCGAGAGGAT
  ATGGGGCCTCGCGAGGCAAGGCTACAGGTGCATCAACTGCAAACTGCTGGTCCATAAGCGCTGCCACGGC
  CTCGTCCCGCTGACCTGCAGGAAGCATATGGATTCTGTCATGCCTTCCCAAGAGCCTCCAGTAGACGACA
  AGAACGAGGACGCCGACCTTCCTTCCGAGGAGACAGATGGAATTGCTTACATTTCCTCATCCCGGAAGCA
  TGACAGCATTAAAGACGACTCGGAGGACCTTAAGCCAGTTATCGATGGGATGGATGGAATCAAAATCTCT
  CAGGGGCTTGGGCTGCAGGACTTTGACCTAATCAGAGTCATCGGGCGCGGGAGCTACGCCAAGGTTCTCC
  TGGTGCGGTTGAAGAAGAATGACCAAATTTACGCCATGAAAGTGGTGAAGAAAGAGCTGGTGCATGATGA
  CGAGGATATTGACTGGGTACAGACAGAGAAGCACGTGTTTGAGCAGGCATCCAGCAACCCCTTCCTGGTC
  GGATTACACTCCTGCTTCCAGACGACAAGTCGGTTGTTCCTGGTCATTGAGTACGTCAACGGCGGGGACC
  TGATGTTCCACATGCAGAGGCAGAGGAAGCTCCCTGAGGAGCACGCCAGGTTCTACGCGGCCGAGATCTG
  CATCGCCCTCAACTTCCTGCACGAGAGGGGGATCATCTACAGGGACCTGAAGCTGGACAACGTCCTCCTG
  GATGCGGACGGGCACATCAAGCTCACAGACTACGGCATGTGCAAGGAAGGCCTGGGCCCTGGTGACACAA
  CGAGCACTTTCTGCGGAACCCCGAATTACATCGCCCCCGAAATCCTGCGGGGAGAGGAGTACGGGTTCAG
  CGTGGACTGGTGGGCGCTGGGAGTCCTCATGTTTGAGATGATGGCCGGGCGCTCCCCGTTCGACATCATC
  ACCGACAACCCGGACATGAACACAGAGGACTACCTTTTCCAAGTGATCCTGGAGAAGCCCATCCGGATCC
  CCCGGTTCCTGTCCGTCAAAGCCTCCCATGTTTTAAAAGGATTTTTAAATAAGGACCCCAAAGAGAGGCT
  CGGCTGCCGGCCACAGACTGGATTTTCTGACATCAAGTCCCACGCGTTCTTCCGCAGCATAGACTGGGAC
  TTGCTGGAGAAGAAGCAGGCGCTCCCTCCATTCCAGCCACAGATCACAGACGACTACGGTCTGGACAACT
  TTGACACACAGTTCACCAGCGAGCCCGTGCAGCTGACCCCAGACGATGAGGATGCCATAAAGAGGATCGA
  CCAGTCAGAGTTCGAAGGCTTTGAGTATATCAACCCATTATTGCTGTCCACCGAGGAGTCGGTGTGA
  
  
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001242874
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001242874.1, NP_001229803.1
• RefSeq Size: 2154 bp
• RefSeq ORF: 1467 bp
• Locus ID: 5590
• Cytogenetics: 1p36.33
• Protein Families: Druggable Genome, Protein Kinase
• Protein Pathways: Chemokine signaling pathway, Endocytosis, Insulin signaling pathway, Tight junction, Type II diabetes mellitus
• Gene Summary: 'Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus compared to isoform 1.