RSPO1 (NM_001242908) Human Untagged Clone

CAT#: SC330056

RSPO1 (untagged) - Homo sapiens R-spondin 1 (RSPO1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RSPO1
• Synonyms: CRISTIN3; RSPO
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001242908, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGGCTTGGGCTGTGTGTGGTGGCCCTGGTTCTGAGCTGGACGCACCTCACCATCAGCAGCCGGGGGA
  TCAAGGGGAAAAGGCAGAGGCGGATCAGTGCCGAGGGGAGCCAGGCCTGTGCCAAAGGCTGTGAGCTCTG
  CTCTGAAGTCAACGGCTGCCTCAAGTGCTCACCCAAGCTGTTCATCCTGCTGGAGAGGAACGACATCCGC
  CAGGTGGGCGTCTGCTTGCCGTCCTGCCCACCTGGATACTTCGACGCCCGCAACCCCGACATGAACAAGT
  GCATCAAATGCAAGATCGAGCACTGTGAGGCCTGCTTCAGCCATAACTTCTGCACCAAGTGTAAGGAGGG
  CTTGTACCTGCACAAGGGCCGCTGCTATCCAGCTTGTCCCGAGGGCTCCTCAGCTGCCAATGGCACCATG
  GAGTGCAGTAGTCCTGCGCAATGTGAAATGAGCGAGTGGTCTCCGTGGGGGCCCTGCTCCAAGAAGCAGC
  AGCTCTGTGGTTTCCGGAGGGGCTCCGAGGAGCGGACACGCAGGGTGCTACATGCCCCTGTGGGGGACCA
  TGCTGCCTGCTCTGACACCAAGGAGACCCGGAGGTGCACAGTGAGGAGAGTGCCGTGTCCTGAGGGGCAG
  AAGAGGAGGAAGGGAGGCCAGGGCCGGCGGGAGAATGCCAACAGGAACCTGGCCAGGAAGGAGAGCAAGG
  AGGCGGGTGCTGGCTCTCGAAGACGCAAGGGGCAGCAACAGCAGCAGCAGCAAGGGACAGTGGGGCCACT
  CACATCTGCAGGGCCTGCCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242908
• ORF Size: 792 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_001242908.1, NP_001229837.1
• RefSeq Size: 2910
• RefSeq ORF: 792
• Locus ID: 284654
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a secreted activator protein with two cysteine-rich, furin-like domains and one thrombospondin type 1 domain. The encoded protein is a ligand for leucine-rich repeat-containing G-protein coupled receptors (LGR proteins) and positively regulates the Wnt signaling pathway. In mice, the protein induces the rapid onset of crypt cell proliferation and increases intestinal epithelial healing, providing a protective effect against chemotherapy-induced adverse effects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
  Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same isoform (1).