CD28 (NM_001243078) Human Untagged Clone

CAT#: SC330077

CD28 (untagged) - Homo sapiens CD28 molecule (CD28), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD28
• Synonyms: Tp44
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243078, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTCAGGCTGCTCTTGGCTCTCAACTTATTCCCTTCAATTCAAGTAACAGGGAAACACCTTTGTCCAA
  GTCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTA
  TAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGT
  GACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCAC
  GCGACTTCGCAGCCTATCGCTCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243078
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001243078.1, NP_001230007.1
• RefSeq Size: 4543 bp
• RefSeq ORF: 306 bp
• Locus ID: 940
• Cytogenetics: 2q33.2
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Allograft rejection, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Systemic lupus erythematosus, T cell receptor signaling pathway, Type I diabetes mellitus, Viral myocarditis
• Gene Summary: 'The protein encoded by this gene is essential for T-cell proliferation and survival, cytokine production, and T-helper type-2 development. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]'
  Transcript Variant: This variant (3) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (3) missing an internal protein segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.