SKP2 (NM_001243120) Human Untagged Clone
CAT#: SC330085
SKP2 (untagged) - Homo sapiens S-phase kinase-associated protein 2, E3 ubiquitin protein ligase (SKP2), transcript variant 3
"NM_001243120" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SKP2 |
Synonyms | FBL1; FBXL1; FLB1; p45 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243120, the custom clone sequence may differ by one or more nucleotides
ATGGACCAACCATTGGCTGAACATTTCAGTACTCTCGCAAAAAACTCAAATTTAGTGCGACTTAACCTTT CTGGGTGTTCTGGATTCTCTGAATTTGCCCTGCAGACTTTGCTAAGCAGCTGTTCCAGACTGGATGAGCT GAACCTCTCCTGGTGTTTTGATTTCACTGAAAAGCATGTACAGGTGGCTGTTGCGCATGTGTCAGAGACC ATCACCCAGCTGAATCTTAGCGGCTACAGAAAGAATCTCCAGAAATCAGATCTCTCTACTTTAGTTAGAA GATGCCCCAATCTTGTCCATCTAGACTTAAGTGATAGTGTCATGCTAAAGAATGACTGCTTTCAGGAATT TTTCCAGCTCAACTACCTCCAACACCTATCACTCAGTCGGTGCTATGATATAATACCTGAAACTTTACTT GAACTTGGAGAAATTCCCACACTAAAAACACTACAAGTTTTTGGAATCGTGCCAGATGGTACCCTTCAAC TGTTAAAGGAAGCCCTTCCTCATCTACAGATTAATTGCTCCCATTTCACCACCATTGCCAGGCCAACTAT TGGCAACAAAAAGAACCAGGAGATATGGGGCATCAAATGCCGACTGACACTGCAAAAGCCCAGTTGTCTA TGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243120 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001243120.1, NP_001230049.1 |
RefSeq Size | 3273 bp |
RefSeq ORF | 633 bp |
Locus ID | 6502 |
Cytogenetics | 5p13.2 |
Protein Families | Druggable Genome |
Protein Pathways | Acute myeloid leukemia, Apoptosis, Cell cycle, Oocyte meiosis, p53 signaling pathway, Pathways in cancer, Progesterone-mediated oocyte maturation, Small cell lung cancer, Ubiquitin mediated proteolysis |
Gene Summary | 'This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class; in addition to an F-box, this protein contains 10 tandem leucine-rich repeats. This protein is an essential element of the cyclin A-CDK2 S-phase kinase. It specifically recognizes phosphorylated cyclin-dependent kinase inhibitor 1B (CDKN1B, also referred to as p27 or KIP1) predominantly in S phase and interacts with S-phase kinase-associated protein 1 (SKP1 or p19). In addition, this gene is established as a protooncogene causally involved in the pathogenesis of lymphomas. Alternative splicing of this gene generates three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2011]' Transcript Variant: This variant (3) lacks two alternate coding exons compared to variant 1. The first causes the translation start site to move downstream while the second is in-frame. The resulting isoform (3) is shorter at the N-terminus and lacks an alternate internal segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232141 | SKP2 (Myc-DDK tagged) - Homo sapiens S-phase kinase-associated protein 2, E3 ubiquitin protein ligase (SKP2), transcript variant 3 |
USD 420.00 |
|
RG232141 | SKP2 (GFP-tagged) - Homo sapiens S-phase kinase-associated protein 2, E3 ubiquitin protein ligase (SKP2), transcript variant 3 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review