Kallikrein 7 (KLK7) (NM_001243126) Human Untagged Clone
CAT#: SC330086
KLK7 (untagged) - Homo sapiens kallikrein-related peptidase 7 (KLK7), transcript variant 4
"NM_001243126" in other vectors (2)
Product Images
Other products for "KLK7"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KLK7 |
Synonyms | hK7; PRSS6; SCCE |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243126, the custom clone sequence may differ by one or more nucleotides
ATGAAGATTTTGGAGCCCAGCTGTGTGCCAGCCCAAGTCGGAACTTGGATCACATCAGATCCTCTCGAGC TCCAGCAGGAGAGGCCCTTCCTCGCCTGGCAGCCCCTGAGCGGCTCAGCAGGGCACCATGGCAAGATCCC TTCTCCTGCCCCTGCAGATCTTACTGCTATCCTTAGCCTTGGAAACTGCAGGAGAAGAAGTGAGTACACC GTGCACCTGGGCAGTGATACGCTGGGCGACAGGAGAGCTCAGAGGATCAAGGCCTCGAAGTCATTCCGCC ACCCCGGCTACTCCACACAGACCCATGTTAATGACCTCATGCTCGTGAAGCTCAATAGCCAGGCCAGGCT GTCATCCATGGTGAAGAAAGTCAGGCTGCCCTCCCGCTGCGAACCCCCTGGAACCACCTGTACTGTCTCC GGCTGGGGCACTACCACGAGCCCAGATGTGACCTTTCCCTCTGACCTCATGTGCGTGGATGTCAAGCTCA TCTCCCCCCAGGACTGCACGAAGGTTTACAAGGACTTACTGGAAAATTCCATGCTGTGCGCTGGCATCCC CGACTCCAAGAAAAACGCCTGCAATGGTGACTCAGGGGGACCGTTGGTGTGCAGAGGTACCCTGCAAGGT CTGGTGTCCTGGGGAACTTTCCCTTGCGGCCAACCCAATGACCCAGGAGTCTACACTCAAGTGTGCAAGT TCACCAAGTGGATAAATGACACCATGAAAAAGCATCGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243126 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001243126.1, NP_001230055.1 |
RefSeq Size | 1956 bp |
RefSeq ORF | 741 bp |
Locus ID | 5650 |
Cytogenetics | 19q13.41 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | 'This gene encodes a member of the kallikrein subfamily of serine proteases. These enzymes have diverse physiological functions and many kallikrein genes are biomarkers for cancer. The encoded protein has chymotrypsin-like activity and plays a role in the proteolysis of intercellular cohesive structures that precedes desquamation, the shedding of the outermost layer of the epidermis. The encoded protein may play a role in cancer invasion and metastasis, and increased expression of this gene is associated with unfavorable prognosis and progression of several types of cancer. Polymorphisms in this gene may play a role in the development of atopic dermatitis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, which is one of fifteen kallikrein subfamily members located in a gene cluster on chromosome 19. [provided by RefSeq, May 2011]' Transcript Variant: This variant (4) uses an alternate upstream start codon compared to variant 1. The 5' CDS is in a different reading frame, but this variant lacks an exon in the coding region which results in a frameshift and in-frame 3' CDS, compared to variant 1. The encoded isoform (3) has a unique N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.