INPP5F (NM_001243195) Human Untagged Clone
CAT#: SC330092
INPP5F (untagged) - Homo sapiens inositol polyphosphate-5-phosphatase F (INPP5F), transcript variant 3
"NM_001243195" in other vectors (2)
Product Images
Other products for "INPP5F"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | INPP5F |
Synonyms | hSAC2; MSTP007; MSTPO47; SAC2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243195, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTCTTCCAAGCCAAGGACCACTACATCCTGCAGCAGGGCGAGCGCGCGCTGTGGTGCAGCCGCC GCGACGGCGGCCTCCAGCTCCGACCCGCTACTGATCTACTTCTTGCCTGGAATCCCATTTGTTTGGGGTT GGTAGAAGGTGTTATTGGGAAAATTCAACTTCATTCAGATCTTCCATGGTGGCTTATTCTAATTCGGCAG AAAGCATTGGTGGGCAAACTCCCAGGAGACCATGAGGTCTGTAAAGTTACCAAAATTGCTGTGCTCTCAC TTTCTGAAATGGAACCTCAGGATCTTGAGCTAGAGCTCTGTAAGAAGCATCATTTTGGTATTAACAAACC AGAGAAGATCATACCATCTCCTGATGACTCAAAGTTTCTACTGAAGACCTTTACGCATATTAAATCCAAT GTGTCTGCTCCTAATAAAAAGAAAGTTAAGGAAAGTAAAGAGAAGGAGAAGTTGGAGAGGAGATTACTTG AAGAGTTGCTGAAGATGTTCATGGACTCAGAATCCTTTTATTATAGCTTGACCTATGACCTGACCAATTC CGTGCAGAGGCAGAGCACTGGGGAGAGGGACGGTCGGCCCCTCTGGCAGAAGGTACCACTCACAGCTCGT AGAGCAGGGTTTGCACTTGGGAAGAAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243195 |
ORF Size | 660 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001243195.1, NP_001230124.1 |
RefSeq Size | 1000 |
RefSeq ORF | 660 |
Locus ID | 22876 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase and contains a Sac domain. The activity of this protein is specific for phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (3) differs in the 3' UTR and lacks a portion of the 3' coding region, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.