INPP5F (NM_001243195) Human Untagged Clone

CAT#: SC330092

INPP5F (untagged) - Homo sapiens inositol polyphosphate-5-phosphatase F (INPP5F), transcript variant 3


  "NM_001243195" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "INPP5F"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol INPP5F
Synonyms hSAC2; MSTP007; MSTPO47; SAC2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243195, the custom clone sequence may differ by one or more nucleotides


ATGGAGCTCTTCCAAGCCAAGGACCACTACATCCTGCAGCAGGGCGAGCGCGCGCTGTGGTGCAGCCGCC
GCGACGGCGGCCTCCAGCTCCGACCCGCTACTGATCTACTTCTTGCCTGGAATCCCATTTGTTTGGGGTT
GGTAGAAGGTGTTATTGGGAAAATTCAACTTCATTCAGATCTTCCATGGTGGCTTATTCTAATTCGGCAG
AAAGCATTGGTGGGCAAACTCCCAGGAGACCATGAGGTCTGTAAAGTTACCAAAATTGCTGTGCTCTCAC
TTTCTGAAATGGAACCTCAGGATCTTGAGCTAGAGCTCTGTAAGAAGCATCATTTTGGTATTAACAAACC
AGAGAAGATCATACCATCTCCTGATGACTCAAAGTTTCTACTGAAGACCTTTACGCATATTAAATCCAAT
GTGTCTGCTCCTAATAAAAAGAAAGTTAAGGAAAGTAAAGAGAAGGAGAAGTTGGAGAGGAGATTACTTG
AAGAGTTGCTGAAGATGTTCATGGACTCAGAATCCTTTTATTATAGCTTGACCTATGACCTGACCAATTC
CGTGCAGAGGCAGAGCACTGGGGAGAGGGACGGTCGGCCCCTCTGGCAGAAGGTACCACTCACAGCTCGT
AGAGCAGGGTTTGCACTTGGGAAGAAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001243195
ORF Size 660 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001243195.1, NP_001230124.1
RefSeq Size 1000
RefSeq ORF 660
Locus ID 22876
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase and contains a Sac domain. The activity of this protein is specific for phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) differs in the 3' UTR and lacks a portion of the 3' coding region, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.