TCF4 (NM_001243235) Human Untagged Clone

CAT#: SC330105

TCF4 (untagged) - Homo sapiens transcription factor 4 (TCF4), transcript variant 11


  "NM_001243235" in other vectors (2)

Reconstitution Protocol

USD 520.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TCF4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TCF4
Synonyms bHLHb19; E2-2; FECD3; ITF-2; ITF2; PTHS; SEF-2; SEF2; SEF2-1; SEF2-1A; SEF2-1B; SEF2-1D; TCF-4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001243235, the custom clone sequence may differ by one or more nucleotides


ATGTACTGCGCATACACAATCCCGGGCATGGGCGGCAACTCTTTGATGTACTACTATAATGGGAAAGCGG
TCTATGCTCCATCAGCAAGCACTGCCGACTACAATAGGGACTCGCCAGGCTATCCTTCCTCCAAACCAGC
AACCAGCACTTTCCCTAGCTCCTTCTTCATGCAAGATGGCCATCACAGCAGTGACCCTTGGAGCTCCTCC
AGTGGGATGAATCAGCCTGGCTATGCAGGAATGTTGGGCAACTCTTCTCATATTCCACAGTCCAGCAGCT
ACTGTAGCCTGCATCCACATGAACGTTTGAGCTATCCATCACACTCCTCAGCAGACATCAATTCCAGTCT
TCCTCCGATGTCCACTTTCCATCGTAGTGGTACAAACCATTACAGCACCTCTTCCTGTACGCCTCCTGCC
AACGGGACAGACAGTATAATGGCAAATAGAGGAAGCGGGGCAGCCGGCAGCTCCCAGACTGGAGATGCTC
TGGGGAAAGCACTTGCTTCGATCTATTCTCCAGATCACACTAACAACAGCTTTTCATCAAACCCTTCAAC
TCCTGTTGGCTCTCCTCCATCTCTCTCAGCAGGCACAGCTGTTTGGTCTAGAAATGGAGGACAGGCCTCA
TCGTCTCCTAATTATGAAGGACCCTTACACTCTTTGCAAAGCCGAATTGAAGATCGTTTAGAAAGACTGG
ATGATGCTATTCATGTTCTCCGGAACCATGCAGTGGGCCCATCCACAGCTATGCCTGGTGGTCATGGGGA
CATGCATGGAATCATTGGACCTTCTCATAATGGAGCCATGGGTGGTCTGGGCTCAGGGTATGGAACCGGC
CTTCTTTCAGCCAACAGACATTCACTCATGGTGGGGACCCATCGTGAAGATGGCGTGGCCCTGAGAGGCA
GCCATTCTCTTCTGCCAAACCAGGTTCCGGTTCCACAGCTTCCTGTCCAGTCTGCGACTTCCCCTGACCT
GAACCCACCCCAGGACCCTTACAGAGGCATGCCACCAGGACTACAGGGGCAGAGTGTCTCCTCTGGCAGC
TCTGAGATCAAATCCGATGACGAGGGTGATGAGAACCTGCAAGACACGAAATCTTCGGAGGACAAGAAAT
TAGATGACGACAAGAAGGATATCAAATCAATTACTAGCAATAATGACGATGAGGACCTGACACCAGAGCA
GAAGGCAGAGCGTGAGAAGGAGCGGAGGATGGCCAACAATGCCCGAGAGCGTCTGCGGGTCCGTGACATC
AACGAGGCTTTCAAAGAGCTCGGCCGCATGGTGCAGCTCCACCTCAAGAGTGACAAGCCCCAGACCAAGC
TCCTGATCCTCCACCAGGCGGTGGCCGTCATCCTCAGTCTGGAGCAGCAAGTCCGAGAAAGGAATCTGAA
TCCGAAAGCTGCGTGTCTGAAAAGAAGGGAGGAAGAGAAGGTGTCCTCAGAGCCTCCCCCTCTCTCCTTG
GCCGGCCCACACCCTGGAATGGGAGACGCATCGAATCACATGGGACAGATGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001243235
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243235.1, NP_001230164.1
RefSeq Size 7349 bp
RefSeq ORF 1524 bp
Locus ID 6925
Cytogenetics 18q21.2
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Gene Summary 'This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]'
Transcript Variant: This variant (11) differs in the 5' UTR and coding sequence and uses an alternate in-frame splice site at the 3' end of an exon compared to variant 3. The resulting isoform (k, also known as TCF4-A-) has a shorter and distinct N-terminus and lacks an alternate internal segment compared to isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Sequence Note: This gene is distinct from TCF7L2 (alias TCF-4).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.