EFHD1 (NM_001243252) Human Untagged Clone

CAT#: SC330108

EFHD1 (untagged) - Homo sapiens EF-hand domain family, member D1 (EFHD1), transcript variant 2


  "NM_001243252" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "EFHD1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EFHD1
Synonyms MST133; MSTP133; PP3051; SWS2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243252, the custom clone sequence may differ by one or more nucleotides


ATGGGAGAGTTGCAGTATGACGCTGGGCGGGATGGCTTCATCGACCTGATGGAGCTGAAGCTGATGATGG
AGAAGCTGGGGGCCCCCCAGACCCACCTGGGCCTGAAGAGCATGATCAAGGAGGTGGATGAGGACTTCGA
TGGCAAGCTCAGCTTCCGGGAGTTCCTGCTCATTTTCCACAAGGCCGCGGCAGGGGAGCTGCAGGAGGAC
AGTGGGCTGATGGCGCTGGCAAAGCTTTCTGAGATCGATGTGGCCCTGGAGGGTGTCAAAGGTGCCAAGA
ACTTCTTTGAAGCCAAGGTCCAAGCCTTGTCATCGGCCAGTAAGTTTGAAGCAGAGTTGAAAGCTGAGCA
AGATGAGCGGAAGCGGGAGGAGGAGGAGAGGCGGCTCCGCCAGGCAGCCTTCCAGAAACTCAAGGCCAAC
TTCAATACATAG


Restriction Sites SgfI-MluI     
ACCN NM_001243252
ORF Size 432 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001243252.1, NP_001230181.1
RefSeq Size 1607
RefSeq ORF 432
Locus ID 80303
Gene Summary This gene encodes a member of the EF-hand super family of calcium binding proteins, which are involved in a variety of cellular processes including mitosis, synaptic transmission, and cytoskeletal rearrangement. The protein encoded by this gene is composed of an N-terminal disordered region, proline-rich elements, two EF-hands, and a C-terminal coiled-coil domain. This protein has been shown to associate with the mitochondrial inner membrane, and in HeLa cells, acts as a novel mitochondrial calcium ion sensor for mitochondrial flash activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and uses an alternate start codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.