EFHD1 (NM_001243252) Human Untagged Clone
CAT#: SC330108
EFHD1 (untagged) - Homo sapiens EF-hand domain family, member D1 (EFHD1), transcript variant 2
"NM_001243252" in other vectors (2)
Product Images
Other products for "EFHD1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EFHD1 |
Synonyms | MST133; MSTP133; PP3051; SWS2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243252, the custom clone sequence may differ by one or more nucleotides
ATGGGAGAGTTGCAGTATGACGCTGGGCGGGATGGCTTCATCGACCTGATGGAGCTGAAGCTGATGATGG AGAAGCTGGGGGCCCCCCAGACCCACCTGGGCCTGAAGAGCATGATCAAGGAGGTGGATGAGGACTTCGA TGGCAAGCTCAGCTTCCGGGAGTTCCTGCTCATTTTCCACAAGGCCGCGGCAGGGGAGCTGCAGGAGGAC AGTGGGCTGATGGCGCTGGCAAAGCTTTCTGAGATCGATGTGGCCCTGGAGGGTGTCAAAGGTGCCAAGA ACTTCTTTGAAGCCAAGGTCCAAGCCTTGTCATCGGCCAGTAAGTTTGAAGCAGAGTTGAAAGCTGAGCA AGATGAGCGGAAGCGGGAGGAGGAGGAGAGGCGGCTCCGCCAGGCAGCCTTCCAGAAACTCAAGGCCAAC TTCAATACATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243252 |
ORF Size | 432 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001243252.1, NP_001230181.1 |
RefSeq Size | 1607 |
RefSeq ORF | 432 |
Locus ID | 80303 |
Gene Summary | This gene encodes a member of the EF-hand super family of calcium binding proteins, which are involved in a variety of cellular processes including mitosis, synaptic transmission, and cytoskeletal rearrangement. The protein encoded by this gene is composed of an N-terminal disordered region, proline-rich elements, two EF-hands, and a C-terminal coiled-coil domain. This protein has been shown to associate with the mitochondrial inner membrane, and in HeLa cells, acts as a novel mitochondrial calcium ion sensor for mitochondrial flash activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and uses an alternate start codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.