ZIC4 (NM_001243256) Human Untagged Clone

CAT#: SC330109

ZIC4 (untagged) - Homo sapiens Zic family member 4 (ZIC4), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZIC4
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243256, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGATACAAGACATCCTTGGTGATGAGGAAACGATTACGGCTTTACCGAAACACTCTTAAAGAGTCAA
  GCGAGAAGCCCTTCAGATGCGAGTTCGAGGGCTGCGAGCGGCGCTTCGCCAACAGCAGCGACCGTAAGAA
  GCATTCGCACGTGCACACTAGCGACAAGCCATACACGTGCAAGGTGCGGGGCTGCGACAAGTGCTACACG
  CACCCCAGCTCGCTGCGTAAGCACATGAAGGTGCACGGGCGCTCGCCGCCGCCCAGCTCTGGCTACGATT
  CGGCTACACCGTCTGCCCTCGTGTCGCCCTCGTCGGACTGCGGCCACAAGTCCCAGGTGGCCTCCTCGGC
  GGCGGTGGCGGCGCGTACCGCCGACTTGAGCGAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243256
• ORF Size: 387 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001243256.1, NP_001230185.1
• RefSeq Size: 3660
• RefSeq ORF: 387
• Locus ID: 84107
• Gene Summary: This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development, and have been associated with X-linked visceral heterotaxy and holoprosencephaly type 5. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 1, a related family member on chromosome 3. Heterozygous deletion of these linked genes is involved in Dandy-Walker malformation, which is a congenital cerebellar malformation. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Dec 2009]
  Transcript Variant: This variant (6) differs in the 5' UTR and has multiple differences in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (4) is shorter than isoform 1.