CD166 (ALCAM) (NM_001243283) Human Untagged Clone

CAT#: SC330113

ALCAM (untagged) - Homo sapiens activated leukocyte cell adhesion molecule (ALCAM), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ALCAM
• Synonyms: CD166; MEMD
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243283, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAATCCAAGGGGGCCAGTTCCTGCCGTCTGCTCTTCTGCCTCTTGATCTCCGCCACCGTCTTCAGGC
  CAGGCCTTGGATGGTATACTGTAAATTCAGCATATGGAGATACCATTATCATACCTTGCCGACTTGACGT
  ACCTCAGAATCTCATGTTTGGCAAATGGAAATATGAAAAGCCCGATGGCTCCCCAGTATTTATTGCCTTC
  AGATCCTCTACAAAGAAAAGTGTGCAGTACGACGATGTACCAGAATACAAAGACAGATTGAACCTCTCAG
  AAAACTACACTTTGTCTATCAGTAATGCAAGGATCAGTGATGAAAAGAGATTTGTGTGCATGCTAGTAAC
  TGAGGACAACGTGTTTGAGGCACCTACAATAGTCAAGGTGTTCAGTAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243283
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001243283.1, NP_001230212.1
• RefSeq Size: 2075 bp
• RefSeq ORF: 402 bp
• Locus ID: 214
• Cytogenetics: 3q13.11
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs)
• Gene Summary: 'This gene encodes activated leukocyte cell adhesion molecule (ALCAM), also known as CD166 (cluster of differentiation 166), which is a member of a subfamily of immunoglobulin receptors with five immunoglobulin-like domains (VVC2C2C2) in the extracellular domain. This protein binds to T-cell differentiation antigene CD6, and is implicated in the processes of cell adhesion and migration. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2011]'
  Transcript Variant: This variant (4) lacks multiple 3' exons, and has an alternate 3' sequence, compared to variant 1. The resulting isoform (4) is the shortest; it is truncated at the C-terminus, compared to isoform 1.