SLC6A13 (NM_001243392) Human Untagged Clone

CAT#: SC330119

SLC6A13 (untagged) - Homo sapiens solute carrier family 6 (neurotransmitter transporter), member 13 (SLC6A13), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC6A13
• Synonyms: GAT-2; GAT2; GAT3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243392, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATAGCAGGGTCTCAGGCACAACCAGTAATGGAGAGACAAAACCAGTGTATCCAGTCATGGAAAAGA
  AGGAGGAAGATGGCACCCTGGAGCGGGGGCACTGGAACAACAAGATGGAGTTTGTGCTGTCAGTGGCTGG
  GGAGATCATTGGCTTAGGCAACGTCTGGAGGTTTCCCTATCTCTGCTACAAAAATGGGGGAGGTGAGATG
  AGAGCCCTTGTGCCACCCCACCCACTCCTGGAAGGAGGATACTTCCATCTCCTGCACTTACGGCCCCTCT
  GGGGAGTCCCATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243392
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001243392.1, NP_001230321.1
• RefSeq Size: 1177 bp
• RefSeq ORF: 294 bp
• Locus ID: 6540
• Cytogenetics: 12p13.33
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: ''
  Transcript Variant: This variant (3) lacks a splice site and a large portion of the coding region, compared to variant 1. The encoded isoform (3) is significantly shorter and has a disctinct C-terminus, compared to isoform 1.